CmoCh17G012960 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCGAAGACAAGGAGCTTATCACTTCCTCCCTTTCTCTCGGCCGTTTCAATCATTTTCTTCTATTTCTTTCTATTGGCCAATTCCGCACTCATTTCGGAGCTCCCTGGTTTCTCCGGCTCTTTCCCTTCCAAGCACTACTCCGGGTGCGGATTTTTGATTTACAGTTATTTTGATGATTTGTTTTTGTTTCTGGAGATTTTTGGCTTTGAATTTGAATGTTATCGGTGTGGATTTTGAAGGTATGTGGAGATCGACGAAAAGCACGGTAGGAATCTGTTCTACTACTTCGTTGAATCGGAGAGGAATCCGATTGAAGATCCGGTGGTTCTGTGGCTGAATGGCGGCCCTGGATGCTCTAGTTTCGATGGTTTCGTTTATGAACACGGTAGGGTTCTTGATCTTCTTCTTTGA ATGGCGAAGACAAGGAGCTTATCACTTCCTCCCTTTCTCTCGGCCGTTTCAATCATTTTCTTCTATTTCTTTCTATTGGCCAATTCCGCACTCATTTCGGAGCTCCCTGGTTTCTCCGGCTCTTTCCCTTCCAAGCACTACTCCGGGTATGTGGAGATCGACGAAAAGCACGGTAGGAATCTGTTCTACTACTTCGTTGAATCGGAGAGGAATCCGATTGAAGATCCGGTGGTTCTGTGGCTGAATGGCGGCCCTGGATGCTCTAGTTTCGATGGTTTCGTTTATGAACACGGTAGGGTTCTTGATCTTCTTCTTTGA ATGGCGAAGACAAGGAGCTTATCACTTCCTCCCTTTCTCTCGGCCGTTTCAATCATTTTCTTCTATTTCTTTCTATTGGCCAATTCCGCACTCATTTCGGAGCTCCCTGGTTTCTCCGGCTCTTTCCCTTCCAAGCACTACTCCGGGTATGTGGAGATCGACGAAAAGCACGGTAGGAATCTGTTCTACTACTTCGTTGAATCGGAGAGGAATCCGATTGAAGATCCGGTGGTTCTGTGGCTGAATGGCGGCCCTGGATGCTCTAGTTTCGATGGTTTCGTTTATGAACACGGTAGGGTTCTTGATCTTCTTCTTTGA
BLAST of CmoCh17G012960 vs. Swiss-Prot
Match: SCP20_ARATH (Serine carboxypeptidase-like 20 OS=Arabidopsis thaliana GN=SCPL20 PE=2 SV=2) HSP 1 Score: 136.0 bits (341), Expect = 2.4e-31 Identity = 59/87 (67.82%), Postives = 74/87 (85.06%), Query Frame = 1
BLAST of CmoCh17G012960 vs. Swiss-Prot
Match: CBP1_ORYSJ (Serine carboxypeptidase 1 OS=Oryza sativa subsp. japonica GN=CBP1 PE=2 SV=1) HSP 1 Score: 127.1 bits (318), Expect = 1.1e-28 Identity = 61/107 (57.01%), Postives = 74/107 (69.16%), Query Frame = 1
BLAST of CmoCh17G012960 vs. Swiss-Prot
Match: CBP1_HORVU (Serine carboxypeptidase 1 OS=Hordeum vulgare GN=CBP1 PE=1 SV=4) HSP 1 Score: 126.7 bits (317), Expect = 1.5e-28 Identity = 54/69 (78.26%), Postives = 61/69 (88.41%), Query Frame = 1
BLAST of CmoCh17G012960 vs. Swiss-Prot
Match: SCP21_ARATH (Serine carboxypeptidase-like 21 OS=Arabidopsis thaliana GN=SCPL21 PE=2 SV=2) HSP 1 Score: 124.4 bits (311), Expect = 7.3e-28 Identity = 54/70 (77.14%), Postives = 61/70 (87.14%), Query Frame = 1
BLAST of CmoCh17G012960 vs. Swiss-Prot
Match: SCP15_ARATH (Serine carboxypeptidase-like 15 OS=Arabidopsis thaliana GN=SCPL15 PE=2 SV=2) HSP 1 Score: 93.6 bits (231), Expect = 1.4e-18 Identity = 38/71 (53.52%), Postives = 52/71 (73.24%), Query Frame = 1
BLAST of CmoCh17G012960 vs. TrEMBL
Match: A0A0A0KA79_CUCSA (Carboxypeptidase OS=Cucumis sativus GN=Csa_7G374580 PE=3 SV=1) HSP 1 Score: 156.8 bits (395), Expect = 1.5e-35 Identity = 72/87 (82.76%), Postives = 80/87 (91.95%), Query Frame = 1
BLAST of CmoCh17G012960 vs. TrEMBL
Match: A0A0J8F339_BETVU (Carboxypeptidase OS=Beta vulgaris subsp. vulgaris GN=BVRB_5g118790 PE=3 SV=1) HSP 1 Score: 142.1 bits (357), Expect = 3.8e-31 Identity = 62/85 (72.94%), Postives = 73/85 (85.88%), Query Frame = 1
BLAST of CmoCh17G012960 vs. TrEMBL
Match: W9R7K7_9ROSA (Serine carboxypeptidase-like 20 OS=Morus notabilis GN=L484_007450 PE=3 SV=1) HSP 1 Score: 140.2 bits (352), Expect = 1.4e-30 Identity = 58/71 (81.69%), Postives = 66/71 (92.96%), Query Frame = 1
BLAST of CmoCh17G012960 vs. TrEMBL
Match: R0GI74_9BRAS (Carboxypeptidase OS=Capsella rubella GN=CARUB_v10004672mg PE=3 SV=1) HSP 1 Score: 139.0 bits (349), Expect = 3.2e-30 Identity = 60/70 (85.71%), Postives = 66/70 (94.29%), Query Frame = 1
BLAST of CmoCh17G012960 vs. TrEMBL
Match: M5VVQ4_PRUPE (Carboxypeptidase OS=Prunus persica GN=PRUPE_ppa004538mg PE=3 SV=1) HSP 1 Score: 137.1 bits (344), Expect = 1.2e-29 Identity = 64/85 (75.29%), Postives = 70/85 (82.35%), Query Frame = 1
BLAST of CmoCh17G012960 vs. TAIR10
Match: AT4G12910.1 (AT4G12910.1 serine carboxypeptidase-like 20) HSP 1 Score: 136.0 bits (341), Expect = 1.4e-32 Identity = 59/87 (67.82%), Postives = 74/87 (85.06%), Query Frame = 1
BLAST of CmoCh17G012960 vs. TAIR10
Match: AT3G25420.1 (AT3G25420.1 serine carboxypeptidase-like 21) HSP 1 Score: 124.4 bits (311), Expect = 4.1e-29 Identity = 54/70 (77.14%), Postives = 61/70 (87.14%), Query Frame = 1
BLAST of CmoCh17G012960 vs. TAIR10
Match: AT3G12240.1 (AT3G12240.1 serine carboxypeptidase-like 15) HSP 1 Score: 93.6 bits (231), Expect = 7.8e-20 Identity = 38/71 (53.52%), Postives = 52/71 (73.24%), Query Frame = 1
BLAST of CmoCh17G012960 vs. TAIR10
Match: AT3G10450.1 (AT3G10450.1 serine carboxypeptidase-like 7) HSP 1 Score: 92.4 bits (228), Expect = 1.7e-19 Identity = 40/88 (45.45%), Postives = 60/88 (68.18%), Query Frame = 1
BLAST of CmoCh17G012960 vs. TAIR10
Match: AT1G73290.1 (AT1G73290.1 serine carboxypeptidase-like 5) HSP 1 Score: 92.0 bits (227), Expect = 2.3e-19 Identity = 43/98 (43.88%), Postives = 64/98 (65.31%), Query Frame = 1
BLAST of CmoCh17G012960 vs. NCBI nr
Match: gi|659100687|ref|XP_008451218.1| (PREDICTED: serine carboxypeptidase-like 20 [Cucumis melo]) HSP 1 Score: 158.7 bits (400), Expect = 5.6e-36 Identity = 73/87 (83.91%), Postives = 80/87 (91.95%), Query Frame = 1
BLAST of CmoCh17G012960 vs. NCBI nr
Match: gi|449462425|ref|XP_004148941.1| (PREDICTED: serine carboxypeptidase-like 20 [Cucumis sativus]) HSP 1 Score: 156.8 bits (395), Expect = 2.1e-35 Identity = 72/87 (82.76%), Postives = 80/87 (91.95%), Query Frame = 1
BLAST of CmoCh17G012960 vs. NCBI nr
Match: gi|731335913|ref|XP_010678976.1| (PREDICTED: serine carboxypeptidase-like 20 [Beta vulgaris subsp. vulgaris]) HSP 1 Score: 142.1 bits (357), Expect = 5.4e-31 Identity = 62/85 (72.94%), Postives = 73/85 (85.88%), Query Frame = 1
BLAST of CmoCh17G012960 vs. NCBI nr
Match: gi|703095698|ref|XP_010095610.1| (Serine carboxypeptidase-like 20 [Morus notabilis]) HSP 1 Score: 140.2 bits (352), Expect = 2.1e-30 Identity = 58/71 (81.69%), Postives = 66/71 (92.96%), Query Frame = 1
BLAST of CmoCh17G012960 vs. NCBI nr
Match: gi|1009151528|ref|XP_015893599.1| (PREDICTED: serine carboxypeptidase-like 20 [Ziziphus jujuba]) HSP 1 Score: 140.2 bits (352), Expect = 2.1e-30 Identity = 64/90 (71.11%), Postives = 74/90 (82.22%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|