CmoCh16G004090 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTAGGGATTTCTGACCACATTCTTCATAGGGCCCTCTTATCTCTTCCTTCTCCGAGCTCGGGTTATGGAAGAAGGAACCGGTCATTGTGGTCGGACTCTATTATGGATTTCTGACCACATTTTCGATAGGGCCCTCTTATCTCTTCCTTTTTCGAGCTCGAGTTATGAAAGAAGGAACTGAAAAGAAAGTATCAGCAACAACAGGTTTTAATACGGGACAGTTCTTGATATTCATATTGATCTATTATGCACCTCTACATCTAGCATTGGGTAGATGTTATATTGATCTATTATGCACCTCTGCATCTAGCATTGGGTAG ATGAAGATAATCAATTCGGTCGTTGTGGGCCCTCTTATCTCTTCCTTCTCCGAGCTCGGGTTATGGAAGAAGGAACCGGTCATTGTGGTCGGACTCTATTATGGATTTCTGACCACATTTTCGATAGGGCCCTCTTATCTCTTCCTTTTTCGAGCTCGAGTTATGAAAGAAGGAACTGAAAAGAAAGTATCAGCAACAACAGGTTTTAATACGGGACAGTTCTTGATATTCATATTGATCTATTATGCACCTCTACATCTAGCATTGGGTAGATGTTATATTGATCTATTATGCACCTCTGCATCTAGCATTGGGTAG ATGAAGATAATCAATTCGGTCGTTGTGGGCCCTCTTATCTCTTCCTTCTCCGAGCTCGGGTTATGGAAGAAGGAACCGGTCATTGTGGTCGGACTCTATTATGGATTTCTGACCACATTTTCGATAGGGCCCTCTTATCTCTTCCTTTTTCGAGCTCGAGTTATGAAAGAAGGAACTGAAAAGAAAGTATCAGCAACAACAGGTTTTAATACGGGACAGTTCTTGATATTCATATTGATCTATTATGCACCTCTACATCTAGCATTGGGTAGATGTTATATTGATCTATTATGCACCTCTGCATCTAGCATTGGGTAG
BLAST of CmoCh16G004090 vs. Swiss-Prot
Match: TI214_ILLOL (Protein TIC 214 OS=Illicium oligandrum GN=TIC214 PE=3 SV=1) HSP 1 Score: 119.8 bits (299), Expect = 1.8e-26 Identity = 62/89 (69.66%), Postives = 73/89 (82.02%), Query Frame = 1
BLAST of CmoCh16G004090 vs. Swiss-Prot
Match: TI214_BUXMI (Protein TIC 214 OS=Buxus microphylla GN=TIC214 PE=3 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 3.1e-26 Identity = 62/89 (69.66%), Postives = 72/89 (80.90%), Query Frame = 1
BLAST of CmoCh16G004090 vs. Swiss-Prot
Match: TI214_NANDO (Protein TIC 214 OS=Nandina domestica GN=TIC214 PE=3 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 3.1e-26 Identity = 62/89 (69.66%), Postives = 72/89 (80.90%), Query Frame = 1
BLAST of CmoCh16G004090 vs. Swiss-Prot
Match: TI214_CALFG (Protein TIC 214 OS=Calycanthus floridus var. glaucus GN=TIC214 PE=3 SV=1) HSP 1 Score: 118.6 bits (296), Expect = 4.0e-26 Identity = 62/91 (68.13%), Postives = 73/91 (80.22%), Query Frame = 1
BLAST of CmoCh16G004090 vs. Swiss-Prot
Match: TI214_COFAR (Protein TIC 214 OS=Coffea arabica GN=TIC214 PE=3 SV=1) HSP 1 Score: 118.6 bits (296), Expect = 4.0e-26 Identity = 62/89 (69.66%), Postives = 71/89 (79.78%), Query Frame = 1
BLAST of CmoCh16G004090 vs. TrEMBL
Match: D3WEV7_9ROSI (Putative RF1 protein OS=Oxalis latifolia GN=ycf1 PE=4 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 9.0e-25 Identity = 63/89 (70.79%), Postives = 72/89 (80.90%), Query Frame = 1
BLAST of CmoCh16G004090 vs. TrEMBL
Match: G0YDQ7_9ROSI (Hypothetical chloroplast RF1 (Fragment) OS=Oxalis latifolia GN=ycf1 PE=4 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 9.0e-25 Identity = 63/89 (70.79%), Postives = 72/89 (80.90%), Query Frame = 1
BLAST of CmoCh16G004090 vs. TrEMBL
Match: A0A0S2IF45_9ROSI (Ycf1 OS=Cucurbita foetidissima GN=ycf1 PE=4 SV=1) HSP 1 Score: 120.2 bits (300), Expect = 1.5e-24 Identity = 62/89 (69.66%), Postives = 72/89 (80.90%), Query Frame = 1
BLAST of CmoCh16G004090 vs. TrEMBL
Match: A0A0S2IDU4_9ROSI (Ycf1 OS=Cucurbita argyrosperma GN=ycf1 PE=4 SV=1) HSP 1 Score: 120.2 bits (300), Expect = 1.5e-24 Identity = 62/89 (69.66%), Postives = 72/89 (80.90%), Query Frame = 1
BLAST of CmoCh16G004090 vs. TrEMBL
Match: A0A0S2IDC6_9ROSI (Uncharacterized protein OS=Cucurbita argyrosperma PE=4 SV=1) HSP 1 Score: 120.2 bits (300), Expect = 1.5e-24 Identity = 62/89 (69.66%), Postives = 72/89 (80.90%), Query Frame = 1
BLAST of CmoCh16G004090 vs. TAIR10
Match: ATCG01130.1 (ATCG01130.1 Ycf1 protein) HSP 1 Score: 111.7 bits (278), Expect = 2.8e-25 Identity = 60/92 (65.22%), Postives = 70/92 (76.09%), Query Frame = 1
BLAST of CmoCh16G004090 vs. TAIR10
Match: ATCG01000.1 (ATCG01000.1 Ycf1 protein) HSP 1 Score: 111.7 bits (278), Expect = 2.8e-25 Identity = 60/92 (65.22%), Postives = 70/92 (76.09%), Query Frame = 1
BLAST of CmoCh16G004090 vs. TAIR10
Match: ATMG00370.1 (ATMG00370.1 Ycf1 protein) HSP 1 Score: 109.8 bits (273), Expect = 1.1e-24 Identity = 56/68 (82.35%), Postives = 60/68 (88.24%), Query Frame = 1
BLAST of CmoCh16G004090 vs. TAIR10
Match: AT2G07739.1 (AT2G07739.1 Ycf1 protein) HSP 1 Score: 107.5 bits (267), Expect = 5.2e-24 Identity = 55/68 (80.88%), Postives = 59/68 (86.76%), Query Frame = 1
BLAST of CmoCh16G004090 vs. NCBI nr
Match: gi|1009104610|ref|YP_009239776.1| (hypothetical chloroplast ycf1 (chloroplast) [Utricularia reniformis]) HSP 1 Score: 122.9 bits (307), Expect = 3.4e-25 Identity = 64/91 (70.33%), Postives = 73/91 (80.22%), Query Frame = 1
BLAST of CmoCh16G004090 vs. NCBI nr
Match: gi|290489072|gb|ADD30920.1| (putative RF1 protein (chloroplast) [Oxalis latifolia]) HSP 1 Score: 120.9 bits (302), Expect = 1.3e-24 Identity = 63/89 (70.79%), Postives = 72/89 (80.90%), Query Frame = 1
BLAST of CmoCh16G004090 vs. NCBI nr
Match: gi|340807136|gb|AEK71734.1| (hypothetical chloroplast RF1 [Oxalis latifolia]) HSP 1 Score: 120.9 bits (302), Expect = 1.3e-24 Identity = 63/89 (70.79%), Postives = 72/89 (80.90%), Query Frame = 1
BLAST of CmoCh16G004090 vs. NCBI nr
Match: gi|952955205|gb|ALO22556.1| (Ycf1 (plastid) [Cucurbita pepo subsp. fraterna]) HSP 1 Score: 120.2 bits (300), Expect = 2.2e-24 Identity = 62/89 (69.66%), Postives = 72/89 (80.90%), Query Frame = 1
BLAST of CmoCh16G004090 vs. NCBI nr
Match: gi|317046229|ref|YP_004072518.1| (hypothetical protein ColaC_p079 [Corynocarpus laevigata]) HSP 1 Score: 120.2 bits (300), Expect = 2.2e-24 Identity = 62/89 (69.66%), Postives = 72/89 (80.90%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|