CmoCh15G006820 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGTTGATGAAAGCAGGAGACGTAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGTGCAGCAGCAGCAGCAGCAGCAGCAGCAGCATTTCCACGTGCTGGCAGTGGACGACAGCCTACTAGAAAGAAAGGTTCTGGAAAAGCTCCTAACAATTTCTTCTTCATGCGAAGGTAAGAAATCCAATCCATAGCTAAATTCACATACTTTCTTTTTTAAAACCATTTTATAATACAATCCAATGCCCAGCAGTGACCTGCGTGGAGTCTGGAGATAAGGCTCTAAGGTATCTGGGCCTGCTTGATGACCTTGACAACTTTTCTTCTCCATTTTCTCCCCCACGTCTCTCCCAACAACAGGTCATTTTAATTAATTTTTTTTTCTATTATAGCCTTTAA ATGGAGTTGATGAAAGCAGGAGACGTAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGTGCAGCAGCAGCAGCAGCAGCAGCAGCAGCATTTCCACGTGCTGGCAGTGGACGACAGCCTACTAGAAAGAAAGGTTCTGGAAAAGCTCCTAACAATTTCTTCTTCATGCGAAGTGACCTGCGTGGAGTCTGGAGATAAGGCTCTAAGCCTTTAA ATGGAGTTGATGAAAGCAGGAGACGTAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGTGCAGCAGCAGCAGCAGCAGCAGCAGCAGCATTTCCACGTGCTGGCAGTGGACGACAGCCTACTAGAAAGAAAGGTTCTGGAAAAGCTCCTAACAATTTCTTCTTCATGCGAAGTGACCTGCGTGGAGTCTGGAGATAAGGCTCTAAGCCTTTAA
BLAST of CmoCh15G006820 vs. TrEMBL
Match: E0CR50_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_18s0001g02540 PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 6.4e-07 Identity = 38/54 (70.37%), Postives = 47/54 (87.04%), Query Frame = 1
BLAST of CmoCh15G006820 vs. TrEMBL
Match: M5Y345_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa010373mg PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.4e-06 Identity = 37/54 (68.52%), Postives = 47/54 (87.04%), Query Frame = 1
BLAST of CmoCh15G006820 vs. TAIR10
Match: AT3G57040.1 (AT3G57040.1 response regulator 9) HSP 1 Score: 50.1 bits (118), Expect = 9.8e-07 Identity = 26/41 (63.41%), Postives = 33/41 (80.49%), Query Frame = 1
BLAST of CmoCh15G006820 vs. TAIR10
Match: AT1G19050.1 (AT1G19050.1 response regulator 7) HSP 1 Score: 50.1 bits (118), Expect = 9.8e-07 Identity = 26/37 (70.27%), Postives = 33/37 (89.19%), Query Frame = 1
BLAST of CmoCh15G006820 vs. TAIR10
Match: AT2G41310.1 (AT2G41310.1 response regulator 3) HSP 1 Score: 48.9 bits (115), Expect = 2.2e-06 Identity = 26/43 (60.47%), Postives = 34/43 (79.07%), Query Frame = 1
BLAST of CmoCh15G006820 vs. TAIR10
Match: AT1G74890.1 (AT1G74890.1 response regulator 15) HSP 1 Score: 48.1 bits (113), Expect = 3.7e-06 Identity = 25/37 (67.57%), Postives = 32/37 (86.49%), Query Frame = 1
BLAST of CmoCh15G006820 vs. NCBI nr
Match: gi|502135894|ref|XP_004502490.1| (PREDICTED: two-component response regulator ARR17-like [Cicer arietinum]) HSP 1 Score: 67.0 bits (162), Expect = 2.2e-08 Identity = 33/43 (76.74%), Postives = 38/43 (88.37%), Query Frame = 1
BLAST of CmoCh15G006820 vs. NCBI nr
Match: gi|1021533056|ref|XP_016163494.1| (PREDICTED: two-component response regulator ORR9-like, partial [Arachis ipaensis]) HSP 1 Score: 66.2 bits (160), Expect = 3.8e-08 Identity = 34/44 (77.27%), Postives = 41/44 (93.18%), Query Frame = 1
BLAST of CmoCh15G006820 vs. NCBI nr
Match: gi|950971001|ref|XP_014500206.1| (PREDICTED: two-component response regulator ORR9-like [Vigna radiata var. radiata]) HSP 1 Score: 65.1 bits (157), Expect = 8.4e-08 Identity = 35/50 (70.00%), Postives = 45/50 (90.00%), Query Frame = 1
BLAST of CmoCh15G006820 vs. NCBI nr
Match: gi|593328020|ref|XP_007137437.1| (hypothetical protein PHAVU_009G127000g [Phaseolus vulgaris]) HSP 1 Score: 64.3 bits (155), Expect = 1.4e-07 Identity = 35/51 (68.63%), Postives = 46/51 (90.20%), Query Frame = 1
BLAST of CmoCh15G006820 vs. NCBI nr
Match: gi|659133431|ref|XP_008466725.1| (PREDICTED: two-component response regulator ARR17-like isoform X2 [Cucumis melo]) HSP 1 Score: 64.3 bits (155), Expect = 1.4e-07 Identity = 40/55 (72.73%), Postives = 49/55 (89.09%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |