CmoCh14G011980 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAAGAAATTCCCCATCACAATTGCTTTCCTTTTCATGGCGGTGATGGTGGCGCTTCTGAGCGGAGCTCGTGTGGCGGAGGCTGTGAACTGCAGCCCTATGGAGCTGTCCTCATGTGCGGGGGCCATCACGTCGTCGTCGACCCCATCCAGCACTTGTTGCAACAAGTTGAGAGAGCAAAAACCATGCCTTTGCGGTTATATAAGGAATCCAGCTTTGAGGCCTTACGTGCAATCTCCTGGCGCCAGAAAGGTTGCTGCCAAGTGTGGCGTTCCCTTCCCCAGCTGCTAG ATGAAGAAATTCCCCATCACAATTGCTTTCCTTTTCATGGCGGTGATGGTGGCGCTTCTGAGCGGAGCTCGTGTGGCGGAGGCTGTGAACTGCAGCCCTATGGAGCTGTCCTCATGTGCGGGGGCCATCACGTCGTCGTCGACCCCATCCAGCACTTGTTGCAACAAGTTGAGAGAGCAAAAACCATGCCTTTGCGGTTATATAAGGAATCCAGCTTTGAGGCCTTACGTGCAATCTCCTGGCGCCAGAAAGGTTGCTGCCAAGTGTGGCGTTCCCTTCCCCAGCTGCTAG ATGAAGAAATTCCCCATCACAATTGCTTTCCTTTTCATGGCGGTGATGGTGGCGCTTCTGAGCGGAGCTCGTGTGGCGGAGGCTGTGAACTGCAGCCCTATGGAGCTGTCCTCATGTGCGGGGGCCATCACGTCGTCGTCGACCCCATCCAGCACTTGTTGCAACAAGTTGAGAGAGCAAAAACCATGCCTTTGCGGTTATATAAGGAATCCAGCTTTGAGGCCTTACGTGCAATCTCCTGGCGCCAGAAAGGTTGCTGCCAAGTGTGGCGTTCCCTTCCCCAGCTGCTAG
BLAST of CmoCh14G011980 vs. Swiss-Prot
Match: NLTP_VIGUN (Probable non-specific lipid-transfer protein AKCS9 OS=Vigna unguiculata PE=2 SV=1) HSP 1 Score: 105.9 bits (263), Expect = 2.5e-22 Identity = 50/94 (53.19%), Postives = 67/94 (71.28%), Query Frame = 1
BLAST of CmoCh14G011980 vs. Swiss-Prot
Match: NLTP2_PRUAR (Non-specific lipid-transfer protein 2 OS=Prunus armeniaca PE=1 SV=1) HSP 1 Score: 99.0 bits (245), Expect = 3.0e-20 Identity = 42/68 (61.76%), Postives = 52/68 (76.47%), Query Frame = 1
BLAST of CmoCh14G011980 vs. Swiss-Prot
Match: NLTP2_APIGA (Non-specific lipid-transfer protein 2 OS=Apium graveolens var. rapaceum PE=1 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 2.4e-17 Identity = 38/61 (62.30%), Postives = 49/61 (80.33%), Query Frame = 1
BLAST of CmoCh14G011980 vs. Swiss-Prot
Match: NLTP2_HORVU (Probable non-specific lipid-transfer protein OS=Hordeum vulgare GN=LTP2 PE=2 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 1.0e-12 Identity = 35/86 (40.70%), Postives = 47/86 (54.65%), Query Frame = 1
BLAST of CmoCh14G011980 vs. Swiss-Prot
Match: NLT2G_WHEAT (Non-specific lipid-transfer protein 2G OS=Triticum aestivum PE=1 SV=2) HSP 1 Score: 70.5 bits (171), Expect = 1.2e-11 Identity = 38/96 (39.58%), Postives = 50/96 (52.08%), Query Frame = 1
BLAST of CmoCh14G011980 vs. TrEMBL
Match: I1N5L5_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_19G002300 PE=4 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 8.3e-25 Identity = 59/96 (61.46%), Postives = 75/96 (78.12%), Query Frame = 1
BLAST of CmoCh14G011980 vs. TrEMBL
Match: A0A0B2QIV0_GLYSO (Putative non-specific lipid-transfer protein AKCS9 OS=Glycine soja GN=glysoja_037194 PE=4 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 8.3e-25 Identity = 59/96 (61.46%), Postives = 75/96 (78.12%), Query Frame = 1
BLAST of CmoCh14G011980 vs. TrEMBL
Match: A0A151RN87_CAJCA (Non-specific lipid-transfer protein 2 OS=Cajanus cajan GN=KK1_034539 PE=4 SV=1) HSP 1 Score: 119.8 bits (299), Expect = 1.8e-24 Identity = 59/96 (61.46%), Postives = 74/96 (77.08%), Query Frame = 1
BLAST of CmoCh14G011980 vs. TrEMBL
Match: B9H330_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0004s09510g PE=4 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 3.1e-24 Identity = 57/96 (59.38%), Postives = 77/96 (80.21%), Query Frame = 1
BLAST of CmoCh14G011980 vs. TrEMBL
Match: A0A0B2S483_GLYSO (Non-specific lipid-transfer protein 2 OS=Glycine soja GN=glysoja_035381 PE=4 SV=1) HSP 1 Score: 118.6 bits (296), Expect = 4.1e-24 Identity = 58/96 (60.42%), Postives = 74/96 (77.08%), Query Frame = 1
BLAST of CmoCh14G011980 vs. TAIR10
Match: AT1G48750.1 (AT1G48750.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 109.4 bits (272), Expect = 1.3e-24 Identity = 54/89 (60.67%), Postives = 66/89 (74.16%), Query Frame = 1
BLAST of CmoCh14G011980 vs. TAIR10
Match: AT3G18280.1 (AT3G18280.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 107.1 bits (266), Expect = 6.3e-24 Identity = 53/90 (58.89%), Postives = 65/90 (72.22%), Query Frame = 1
BLAST of CmoCh14G011980 vs. TAIR10
Match: AT5G38195.1 (AT5G38195.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 78.2 bits (191), Expect = 3.1e-15 Identity = 41/96 (42.71%), Postives = 55/96 (57.29%), Query Frame = 1
BLAST of CmoCh14G011980 vs. TAIR10
Match: AT5G38170.1 (AT5G38170.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 77.0 bits (188), Expect = 6.9e-15 Identity = 33/68 (48.53%), Postives = 45/68 (66.18%), Query Frame = 1
BLAST of CmoCh14G011980 vs. TAIR10
Match: AT5G38160.1 (AT5G38160.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 75.1 bits (183), Expect = 2.6e-14 Identity = 35/82 (42.68%), Postives = 49/82 (59.76%), Query Frame = 1
BLAST of CmoCh14G011980 vs. NCBI nr
Match: gi|659086721|ref|XP_008444081.1| (PREDICTED: non-specific lipid-transfer protein 2-like [Cucumis melo]) HSP 1 Score: 129.8 bits (325), Expect = 2.6e-27 Identity = 63/95 (66.32%), Postives = 76/95 (80.00%), Query Frame = 1
BLAST of CmoCh14G011980 vs. NCBI nr
Match: gi|734371828|gb|KHN19692.1| (Putative non-specific lipid-transfer protein AKCS9 [Glycine soja]) HSP 1 Score: 120.9 bits (302), Expect = 1.2e-24 Identity = 59/96 (61.46%), Postives = 75/96 (78.12%), Query Frame = 1
BLAST of CmoCh14G011980 vs. NCBI nr
Match: gi|1012332591|gb|KYP44017.1| (Non-specific lipid-transfer protein 2 [Cajanus cajan]) HSP 1 Score: 119.8 bits (299), Expect = 2.6e-24 Identity = 59/96 (61.46%), Postives = 74/96 (77.08%), Query Frame = 1
BLAST of CmoCh14G011980 vs. NCBI nr
Match: gi|224079367|ref|XP_002305838.1| (hypothetical protein POPTR_0004s09510g [Populus trichocarpa]) HSP 1 Score: 119.0 bits (297), Expect = 4.5e-24 Identity = 57/96 (59.38%), Postives = 77/96 (80.21%), Query Frame = 1
BLAST of CmoCh14G011980 vs. NCBI nr
Match: gi|947084850|gb|KRH33571.1| (hypothetical protein GLYMA_10G132500 [Glycine max]) HSP 1 Score: 118.6 bits (296), Expect = 5.9e-24 Identity = 58/96 (60.42%), Postives = 74/96 (77.08%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|