CmoCh14G011950 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAAGAAAAGGCTTTGCCTTTTGGTGGCAGTGGTGGCGATGGTGGTGCTGCTCACTGGAGCTGGAGTGGCAGAGGCGGTGAAGTGCGATCCGATGGAGATGAGAGCATGTCTTCCTGCAATCAAATCCTCAGAGCCGCCGACAGCGGAATGCTGTGATAAAGTGAAGAAGCAAGAGGGATGCCTTTGTGAATACCTGAAAAGCCCAATATTGAAGCCTTATTTAGAGTCACCCAATGCTAAAAAGATAGCTTCTTCCTGTGGGGTTCCCATCCCCACCTGCTAG ATGAAGAAAAGGCTTTGCCTTTTGGTGGCAGTGGTGGCGATGGTGGTGCTGCTCACTGGAGCTGGAGTGGCAGAGGCGGTGAAGTGCGATCCGATGGAGATGAGAGCATGTCTTCCTGCAATCAAATCCTCAGAGCCGCCGACAGCGGAATGCTGTGATAAAGTGAAGAAGCAAGAGGGATGCCTTTGTGAATACCTGAAAAGCCCAATATTGAAGCCTTATTTAGAGTCACCCAATGCTAAAAAGATAGCTTCTTCCTGTGGGGTTCCCATCCCCACCTGCTAG ATGAAGAAAAGGCTTTGCCTTTTGGTGGCAGTGGTGGCGATGGTGGTGCTGCTCACTGGAGCTGGAGTGGCAGAGGCGGTGAAGTGCGATCCGATGGAGATGAGAGCATGTCTTCCTGCAATCAAATCCTCAGAGCCGCCGACAGCGGAATGCTGTGATAAAGTGAAGAAGCAAGAGGGATGCCTTTGTGAATACCTGAAAAGCCCAATATTGAAGCCTTATTTAGAGTCACCCAATGCTAAAAAGATAGCTTCTTCCTGTGGGGTTCCCATCCCCACCTGCTAG
BLAST of CmoCh14G011950 vs. Swiss-Prot
Match: NLTP_VIGUN (Probable non-specific lipid-transfer protein AKCS9 OS=Vigna unguiculata PE=2 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.5e-19 Identity = 46/95 (48.42%), Postives = 64/95 (67.37%), Query Frame = 1
BLAST of CmoCh14G011950 vs. Swiss-Prot
Match: NLTP2_PRUAR (Non-specific lipid-transfer protein 2 OS=Prunus armeniaca PE=1 SV=1) HSP 1 Score: 84.3 bits (207), Expect = 7.5e-16 Identity = 34/68 (50.00%), Postives = 47/68 (69.12%), Query Frame = 1
BLAST of CmoCh14G011950 vs. Swiss-Prot
Match: NLTP2_HORVU (Probable non-specific lipid-transfer protein OS=Hordeum vulgare GN=LTP2 PE=2 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 3.2e-14 Identity = 34/94 (36.17%), Postives = 53/94 (56.38%), Query Frame = 1
BLAST of CmoCh14G011950 vs. Swiss-Prot
Match: NLTPX_ORYSI (Non-specific lipid-transfer protein 2 OS=Oryza sativa subsp. indica GN=LTP-2 PE=3 SV=2) HSP 1 Score: 79.0 bits (193), Expect = 3.2e-14 Identity = 40/95 (42.11%), Postives = 54/95 (56.84%), Query Frame = 1
BLAST of CmoCh14G011950 vs. Swiss-Prot
Match: NLTP2_APIGA (Non-specific lipid-transfer protein 2 OS=Apium graveolens var. rapaceum PE=1 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 9.2e-14 Identity = 33/63 (52.38%), Postives = 45/63 (71.43%), Query Frame = 1
BLAST of CmoCh14G011950 vs. TrEMBL
Match: A0A0A0KW09_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G141230 PE=4 SV=1) HSP 1 Score: 138.3 bits (347), Expect = 4.9e-30 Identity = 67/93 (72.04%), Postives = 80/93 (86.02%), Query Frame = 1
BLAST of CmoCh14G011950 vs. TrEMBL
Match: B9H330_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0004s09510g PE=4 SV=1) HSP 1 Score: 107.1 bits (266), Expect = 1.2e-20 Identity = 49/92 (53.26%), Postives = 68/92 (73.91%), Query Frame = 1
BLAST of CmoCh14G011950 vs. TrEMBL
Match: A5JUZ7_SESIN (Lipid transfer protein OS=Sesamum indicum GN=LTP1 PE=2 SV=1) HSP 1 Score: 105.1 bits (261), Expect = 4.6e-20 Identity = 51/96 (53.12%), Postives = 70/96 (72.92%), Query Frame = 1
BLAST of CmoCh14G011950 vs. TrEMBL
Match: A0A0B2QIV0_GLYSO (Putative non-specific lipid-transfer protein AKCS9 OS=Glycine soja GN=glysoja_037194 PE=4 SV=1) HSP 1 Score: 103.2 bits (256), Expect = 1.7e-19 Identity = 48/95 (50.53%), Postives = 68/95 (71.58%), Query Frame = 1
BLAST of CmoCh14G011950 vs. TrEMBL
Match: I1N5L5_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_19G002300 PE=4 SV=1) HSP 1 Score: 103.2 bits (256), Expect = 1.7e-19 Identity = 48/95 (50.53%), Postives = 68/95 (71.58%), Query Frame = 1
BLAST of CmoCh14G011950 vs. TAIR10
Match: AT1G48750.1 (AT1G48750.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 91.3 bits (225), Expect = 3.5e-19 Identity = 40/94 (42.55%), Postives = 64/94 (68.09%), Query Frame = 1
BLAST of CmoCh14G011950 vs. TAIR10
Match: AT3G18280.1 (AT3G18280.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 88.6 bits (218), Expect = 2.3e-18 Identity = 42/94 (44.68%), Postives = 63/94 (67.02%), Query Frame = 1
BLAST of CmoCh14G011950 vs. TAIR10
Match: AT1G07747.1 (AT1G07747.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 77.0 bits (188), Expect = 6.8e-15 Identity = 36/94 (38.30%), Postives = 56/94 (59.57%), Query Frame = 1
BLAST of CmoCh14G011950 vs. TAIR10
Match: AT5G38160.1 (AT5G38160.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 76.6 bits (187), Expect = 8.9e-15 Identity = 35/86 (40.70%), Postives = 54/86 (62.79%), Query Frame = 1
BLAST of CmoCh14G011950 vs. TAIR10
Match: AT2G14846.1 (AT2G14846.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 74.7 bits (182), Expect = 3.4e-14 Identity = 30/70 (42.86%), Postives = 45/70 (64.29%), Query Frame = 1
BLAST of CmoCh14G011950 vs. NCBI nr
Match: gi|700198657|gb|KGN53815.1| (hypothetical protein Csa_4G141230 [Cucumis sativus]) HSP 1 Score: 138.3 bits (347), Expect = 7.0e-30 Identity = 67/93 (72.04%), Postives = 80/93 (86.02%), Query Frame = 1
BLAST of CmoCh14G011950 vs. NCBI nr
Match: gi|659086709|ref|XP_008444077.1| (PREDICTED: non-specific lipid-transfer protein 2-like [Cucumis melo]) HSP 1 Score: 134.0 bits (336), Expect = 1.3e-28 Identity = 65/93 (69.89%), Postives = 78/93 (83.87%), Query Frame = 1
BLAST of CmoCh14G011950 vs. NCBI nr
Match: gi|694439405|ref|XP_009346593.1| (PREDICTED: non-specific lipid-transfer protein 2-like [Pyrus x bretschneideri]) HSP 1 Score: 111.3 bits (277), Expect = 9.2e-22 Identity = 50/89 (56.18%), Postives = 68/89 (76.40%), Query Frame = 1
BLAST of CmoCh14G011950 vs. NCBI nr
Match: gi|224079367|ref|XP_002305838.1| (hypothetical protein POPTR_0004s09510g [Populus trichocarpa]) HSP 1 Score: 107.1 bits (266), Expect = 1.7e-20 Identity = 49/92 (53.26%), Postives = 68/92 (73.91%), Query Frame = 1
BLAST of CmoCh14G011950 vs. NCBI nr
Match: gi|658053478|ref|XP_008362493.1| (PREDICTED: non-specific lipid-transfer protein 2-like [Malus domestica]) HSP 1 Score: 105.9 bits (263), Expect = 3.9e-20 Identity = 49/89 (55.06%), Postives = 64/89 (71.91%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|