CmoCh14G011420 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.TTTCCACGCTTGAAAAAAAATAACTTGGGACGTATCGCTCAAATCATTGGTCCGGTACTAGATGTAGCTTTTCCCCCGGGCAAAATGCCTAATATTTACAACGCTTTGATAGTTAAAGGTCAAGATATTGCCGGTCAAGAAATTAATGAAAATGCCTAATATTTACAACGCTTTGATAGTTAAAGGTCAAGATATTGCCGGTCAAGAAATTAATGTGACTTGTGAAGTACAACAACGCTTTGATAGTTAAAGGTCAAGATATTGCCGGTCAAGAAATTAATGTGACTTGTGAAGTACAACAATTATTAGGAAATAATTGA TTTCCACGCTTGAAAAAAAATAACTTGGGACGTATCGCTCAAATCATTGGTCCGGTACTAGATGTAGCTTTTCCCCCGGGCAAAATGCCTAATATTTACAACGCTTTGATAGTCAAGATATTGCCGGTCAAGAAATTAATGAAAATGCCTAATATTTACAACGCTTTGATAGTTAAAGGTCAAGATATTGCCGGTCAAGAAATTAATTACAACAACGCTTTGATAGTTAAAGGTCAAGATATTGCCGGTCAAGAAATTAATGTGACTTGTGAAGTACAACAATTATTAGGAAATAATTGA TTTCCACGCTTGAAAAAAAATAACTTGGGACGTATCGCTCAAATCATTGGTCCGGTACTAGATGTAGCTTTTCCCCCGGGCAAAATGCCTAATATTTACAACGCTTTGATAGTCAAGATATTGCCGGTCAAGAAATTAATGAAAATGCCTAATATTTACAACGCTTTGATAGTTAAAGGTCAAGATATTGCCGGTCAAGAAATTAATTACAACAACGCTTTGATAGTTAAAGGTCAAGATATTGCCGGTCAAGAAATTAATGTGACTTGTGAAGTACAACAATTATTAGGAAATAATTGA
BLAST of CmoCh14G011420 vs. Swiss-Prot
Match: ATPB_CUCSA (ATP synthase subunit beta, chloroplastic OS=Cucumis sativus GN=atpB PE=3 SV=2) HSP 1 Score: 93.6 bits (231), Expect = 1.3e-18 Identity = 56/96 (58.33%), Postives = 58/96 (60.42%), Query Frame = 1
BLAST of CmoCh14G011420 vs. Swiss-Prot
Match: ATPB_MORIN (ATP synthase subunit beta, chloroplastic OS=Morus indica GN=atpB PE=3 SV=1) HSP 1 Score: 88.6 bits (218), Expect = 4.2e-17 Identity = 52/98 (53.06%), Postives = 56/98 (57.14%), Query Frame = 1
BLAST of CmoCh14G011420 vs. Swiss-Prot
Match: ATPB_MANES (ATP synthase subunit beta, chloroplastic OS=Manihot esculenta GN=atpB PE=3 SV=1) HSP 1 Score: 88.6 bits (218), Expect = 4.2e-17 Identity = 53/96 (55.21%), Postives = 56/96 (58.33%), Query Frame = 1
BLAST of CmoCh14G011420 vs. Swiss-Prot
Match: ATPB_RAPSA (ATP synthase subunit beta, chloroplastic OS=Raphanus sativus GN=atpB PE=2 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 7.2e-17 Identity = 52/95 (54.74%), Postives = 55/95 (57.89%), Query Frame = 1
BLAST of CmoCh14G011420 vs. Swiss-Prot
Match: ATPB_BRANA (ATP synthase subunit beta, chloroplastic OS=Brassica napus GN=atpB PE=3 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 7.2e-17 Identity = 52/95 (54.74%), Postives = 55/95 (57.89%), Query Frame = 1
BLAST of CmoCh14G011420 vs. TrEMBL
Match: A0A0S2IHG8_CUCPE (ATP synthase subunit beta OS=Cucurbita pepo var. ozarkana GN=atpB PE=3 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 6.5e-17 Identity = 57/96 (59.38%), Postives = 58/96 (60.42%), Query Frame = 1
BLAST of CmoCh14G011420 vs. TrEMBL
Match: A0A0S2IEY8_9ROSI (ATP synthase subunit beta OS=Cucurbita argyrosperma subsp. sororia GN=atpB PE=3 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 6.5e-17 Identity = 57/96 (59.38%), Postives = 58/96 (60.42%), Query Frame = 1
BLAST of CmoCh14G011420 vs. TrEMBL
Match: A0A0S2IDQ9_9ROSI (ATP synthase subunit beta OS=Cucurbita argyrosperma GN=atpB PE=3 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 6.5e-17 Identity = 57/96 (59.38%), Postives = 58/96 (60.42%), Query Frame = 1
BLAST of CmoCh14G011420 vs. TrEMBL
Match: A0A0S2IGP7_CUCMO (ATP synthase subunit beta OS=Cucurbita moschata GN=atpB PE=3 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 6.5e-17 Identity = 57/96 (59.38%), Postives = 58/96 (60.42%), Query Frame = 1
BLAST of CmoCh14G011420 vs. TrEMBL
Match: A0A0S2IGI6_CUCPE (ATP synthase subunit beta OS=Cucurbita pepo subsp. pepo GN=atpB PE=3 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 6.5e-17 Identity = 57/96 (59.38%), Postives = 58/96 (60.42%), Query Frame = 1
BLAST of CmoCh14G011420 vs. TAIR10
Match: ATCG00480.1 (ATCG00480.1 ATP synthase subunit beta) HSP 1 Score: 85.5 bits (210), Expect = 2.0e-17 Identity = 51/95 (53.68%), Postives = 54/95 (56.84%), Query Frame = 1
BLAST of CmoCh14G011420 vs. NCBI nr
Match: gi|952954366|gb|ALO21730.1| (AtpB (plastid) [Cucurbita argyrosperma]) HSP 1 Score: 94.7 bits (234), Expect = 9.4e-17 Identity = 57/96 (59.38%), Postives = 58/96 (60.42%), Query Frame = 1
BLAST of CmoCh14G011420 vs. NCBI nr
Match: gi|346578198|ref|YP_004841790.1| (ATP synthase CF1 beta subunit [Cucumis melo subsp. melo]) HSP 1 Score: 94.7 bits (234), Expect = 9.4e-17 Identity = 57/96 (59.38%), Postives = 58/96 (60.42%), Query Frame = 1
BLAST of CmoCh14G011420 vs. NCBI nr
Match: gi|952955214|gb|ALO22565.1| (AtpB (plastid) [Cucurbita pepo subsp. fraterna]) HSP 1 Score: 94.7 bits (234), Expect = 9.4e-17 Identity = 57/96 (59.38%), Postives = 58/96 (60.42%), Query Frame = 1
BLAST of CmoCh14G011420 vs. NCBI nr
Match: gi|14718024|gb|AAK72753.1| (ATP synthase beta subunit, partial (chloroplast) [Cucurbita pepo]) HSP 1 Score: 94.0 bits (232), Expect = 1.6e-16 Identity = 56/96 (58.33%), Postives = 58/96 (60.42%), Query Frame = 1
BLAST of CmoCh14G011420 vs. NCBI nr
Match: gi|590000422|ref|YP_009004051.1| (ATP synthase CF1 beta subunit [Cucumis hystrix]) HSP 1 Score: 93.6 bits (231), Expect = 2.1e-16 Identity = 56/96 (58.33%), Postives = 58/96 (60.42%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|