CmoCh14G011010 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGTGCCGGAGCTGCTACAATTGCTTCACCGGGAGCTGCTGTCGGTATTGGAAACGTGTTCAGTTCTTTGATCCATTCCGTGGCGAGAAATCCCTCATTGGCTAAACAATCATTTGGTTATGCCATTTTGGGCTTTGCTCTAACAGAAGCTATTGCATTGTTTGCTCCAATGATGGCCTTTTTGATCTCATTCGTATTCCGATCGAAGAAGGGTTCAGTCTCATAA ATGGGTGCCGGAGCTGCTACAATTGCTTCACCGGGAGCTGCTGTCGGTATTGGAAACGTGTTCAGTTCTTTGATCCATTCCGTGGCGAGAAATCCCTCATTGGCTAAACAATCATTTGGTTATGCCATTTTGGGCTTTGCTCTAACAGAAGCTATTGCATTGTTTGCTCCAATGATGGCCTTTTTGATCTCATTCGTATTCCGATCGAAGAAGGGTTCAGTCTCATAA ATGGGTGCCGGAGCTGCTACAATTGCTTCACCGGGAGCTGCTGTCGGTATTGGAAACGTGTTCAGTTCTTTGATCCATTCCGTGGCGAGAAATCCCTCATTGGCTAAACAATCATTTGGTTATGCCATTTTGGGCTTTGCTCTAACAGAAGCTATTGCATTGTTTGCTCCAATGATGGCCTTTTTGATCTCATTCGTATTCCGATCGAAGAAGGGTTCAGTCTCATAA
BLAST of CmoCh14G011010 vs. Swiss-Prot
Match: ATP9_MALDO (ATP synthase subunit 9, mitochondrial OS=Malus domestica GN=ATP9 PE=3 SV=1) HSP 1 Score: 115.2 bits (287), Expect = 3.2e-25 Identity = 64/69 (92.75%), Postives = 66/69 (95.65%), Query Frame = 1
BLAST of CmoCh14G011010 vs. Swiss-Prot
Match: ATP9_BRANA (ATP synthase subunit 9, mitochondrial OS=Brassica napus GN=ATP9 PE=2 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.2e-25 Identity = 63/67 (94.03%), Postives = 65/67 (97.01%), Query Frame = 1
BLAST of CmoCh14G011010 vs. Swiss-Prot
Match: ATP9_PETHY (ATP synthase subunit 9, mitochondrial OS=Petunia hybrida GN=ATP9 PE=2 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 1.0e-23 Identity = 62/67 (92.54%), Postives = 63/67 (94.03%), Query Frame = 1
BLAST of CmoCh14G011010 vs. Swiss-Prot
Match: ATP9_SOLLC (ATP synthase subunit 9, mitochondrial OS=Solanum lycopersicum GN=ATP9 PE=3 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 1.0e-23 Identity = 62/67 (92.54%), Postives = 63/67 (94.03%), Query Frame = 1
BLAST of CmoCh14G011010 vs. Swiss-Prot
Match: ATP9_TOBAC (ATP synthase subunit 9, mitochondrial OS=Nicotiana tabacum GN=ATP9 PE=2 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 1.0e-23 Identity = 62/67 (92.54%), Postives = 63/67 (94.03%), Query Frame = 1
BLAST of CmoCh14G011010 vs. TrEMBL
Match: G3EU40_CUCME (ATP synthase subunit 9, mitochondrial OS=Cucumis melo subsp. melo GN=atp9 PE=3 SV=1) HSP 1 Score: 121.7 bits (304), Expect = 3.8e-25 Identity = 68/71 (95.77%), Postives = 69/71 (97.18%), Query Frame = 1
BLAST of CmoCh14G011010 vs. TrEMBL
Match: W5XKB5_AEGLO (ATP synthase subunit 9, mitochondrial OS=Aegilops longissima PE=3 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 1.9e-24 Identity = 67/73 (91.78%), Postives = 68/73 (93.15%), Query Frame = 1
BLAST of CmoCh14G011010 vs. TrEMBL
Match: Q37724_SECCE (ATP synthase subunit 9, mitochondrial OS=Secale cereale GN=atp9 PE=3 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 1.9e-24 Identity = 67/73 (91.78%), Postives = 68/73 (93.15%), Query Frame = 1
BLAST of CmoCh14G011010 vs. TrEMBL
Match: W5AAD2_WHEAT (Uncharacterized protein OS=Triticum aestivum GN=atp9 PE=3 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 1.9e-24 Identity = 67/73 (91.78%), Postives = 68/73 (93.15%), Query Frame = 1
BLAST of CmoCh14G011010 vs. TrEMBL
Match: Q42931_9POAL (ATP synthase subunit 9 OS=Triticum durum x Triticosecale sp. GN=atp9 PE=3 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 1.9e-24 Identity = 67/73 (91.78%), Postives = 68/73 (93.15%), Query Frame = 1
BLAST of CmoCh14G011010 vs. TAIR10
Match: AT2G07671.1 (AT2G07671.1 ATP synthase subunit C family protein) HSP 1 Score: 114.8 bits (286), Expect = 2.3e-26 Identity = 63/67 (94.03%), Postives = 65/67 (97.01%), Query Frame = 1
BLAST of CmoCh14G011010 vs. TAIR10
Match: ATMG01080.1 (ATMG01080.1 mitochondrial F0-ATPase subunit 9) HSP 1 Score: 114.8 bits (286), Expect = 2.3e-26 Identity = 63/67 (94.03%), Postives = 65/67 (97.01%), Query Frame = 1
BLAST of CmoCh14G011010 vs. TAIR10
Match: ATMG00040.1 (ATMG00040.1 ATP synthase subunit C family protein) HSP 1 Score: 60.5 bits (145), Expect = 5.2e-10 Identity = 32/35 (91.43%), Postives = 34/35 (97.14%), Query Frame = 1
BLAST of CmoCh14G011010 vs. NCBI nr
Match: gi|345034446|gb|AEN56131.1| (ATPase subunit 9 [Cucumis melo subsp. melo]) HSP 1 Score: 121.7 bits (304), Expect = 5.4e-25 Identity = 68/71 (95.77%), Postives = 69/71 (97.18%), Query Frame = 1
BLAST of CmoCh14G011010 vs. NCBI nr
Match: gi|81176510|ref|YP_398394.1| (atp9 (mitochondrion) [Triticum aestivum]) HSP 1 Score: 119.4 bits (298), Expect = 2.7e-24 Identity = 67/73 (91.78%), Postives = 68/73 (93.15%), Query Frame = 1
BLAST of CmoCh14G011010 vs. NCBI nr
Match: gi|1016880306|ref|YP_009243662.1| (ATPase subunit 9 (mitochondrion) [Cannabis sativa]) HSP 1 Score: 119.0 bits (297), Expect = 3.5e-24 Identity = 66/70 (94.29%), Postives = 67/70 (95.71%), Query Frame = 1
BLAST of CmoCh14G011010 vs. NCBI nr
Match: gi|849123220|ref|YP_009153923.1| (ATP synthase F1 subunit 9 (mitochondrion) [Gossypium hirsutum]) HSP 1 Score: 118.6 bits (296), Expect = 4.6e-24 Identity = 68/75 (90.67%), Postives = 68/75 (90.67%), Query Frame = 1
BLAST of CmoCh14G011010 vs. NCBI nr
Match: gi|661813580|ref|YP_009045770.1| (ATP synthase subunit 9 (mitochondrion) [Batis maritima]) HSP 1 Score: 117.9 bits (294), Expect = 7.8e-24 Identity = 66/68 (97.06%), Postives = 66/68 (97.06%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|