CmoCh14G010250 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGTTGCAGTTCTTCTTCACGGTGGCTTTCTCTGCAGTACCTTTGACTCTCTATGTTCCGCCTCTCCGGAGCTTCAATCTCTTCGTCGAGACCATGGAGGAGATACTTCGCGAGTCCAGAACGTATACCAATCGGGTCTATCCGCGGGCTCGGCATGTTTGGTTTAGGGTTTTGGATTGTGTTCTTTGCAGCACCAGGTAG ATGTTGCAGTTCTTCTTCACGGTGGCTTTCTCTGCAGTACCTTTGACTCTCTATGTTCCGCCTCTCCGGAGCTTCAATCTCTTCGTCGAGACCATGGAGGAGATACTTCGCGAGTCCAGAACGTATACCAATCGGGTCTATCCGCGGGCTCGGCATGTTTGGTTTAGGGTTTTGGATTGTGTTCTTTGCAGCACCAGGTAG ATGTTGCAGTTCTTCTTCACGGTGGCTTTCTCTGCAGTACCTTTGACTCTCTATGTTCCGCCTCTCCGGAGCTTCAATCTCTTCGTCGAGACCATGGAGGAGATACTTCGCGAGTCCAGAACGTATACCAATCGGGTCTATCCGCGGGCTCGGCATGTTTGGTTTAGGGTTTTGGATTGTGTTCTTTGCAGCACCAGGTAG
BLAST of CmoCh14G010250 vs. TrEMBL
Match: A0A0A0LD25_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G697900 PE=4 SV=1) HSP 1 Score: 133.7 bits (335), Expect = 8.5e-29 Identity = 64/66 (96.97%), Postives = 65/66 (98.48%), Query Frame = 1
BLAST of CmoCh14G010250 vs. TrEMBL
Match: M5X2Z7_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa014472mg PE=4 SV=1) HSP 1 Score: 116.3 bits (290), Expect = 1.4e-23 Identity = 54/66 (81.82%), Postives = 60/66 (90.91%), Query Frame = 1
BLAST of CmoCh14G010250 vs. TrEMBL
Match: A0A067D090_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g043785mg PE=4 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.1e-23 Identity = 54/66 (81.82%), Postives = 59/66 (89.39%), Query Frame = 1
BLAST of CmoCh14G010250 vs. TrEMBL
Match: V4VIB3_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10033564mg PE=4 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.1e-23 Identity = 54/66 (81.82%), Postives = 59/66 (89.39%), Query Frame = 1
BLAST of CmoCh14G010250 vs. TrEMBL
Match: A0A059ADU6_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_J01270 PE=4 SV=1) HSP 1 Score: 114.4 bits (285), Expect = 5.3e-23 Identity = 52/65 (80.00%), Postives = 60/65 (92.31%), Query Frame = 1
BLAST of CmoCh14G010250 vs. TAIR10
Match: AT3G52105.1 (AT3G52105.1 unknown protein) HSP 1 Score: 86.3 bits (212), Expect = 7.9e-18 Identity = 40/66 (60.61%), Postives = 50/66 (75.76%), Query Frame = 1
BLAST of CmoCh14G010250 vs. NCBI nr
Match: gi|778682809|ref|XP_011651782.1| (PREDICTED: uncharacterized protein LOC105434940 [Cucumis sativus]) HSP 1 Score: 133.7 bits (335), Expect = 1.2e-28 Identity = 64/66 (96.97%), Postives = 65/66 (98.48%), Query Frame = 1
BLAST of CmoCh14G010250 vs. NCBI nr
Match: gi|1009129401|ref|XP_015881745.1| (PREDICTED: uncharacterized protein LOC107417643 [Ziziphus jujuba]) HSP 1 Score: 120.2 bits (300), Expect = 1.4e-24 Identity = 54/66 (81.82%), Postives = 62/66 (93.94%), Query Frame = 1
BLAST of CmoCh14G010250 vs. NCBI nr
Match: gi|596012486|ref|XP_007218667.1| (hypothetical protein PRUPE_ppa014472mg [Prunus persica]) HSP 1 Score: 116.3 bits (290), Expect = 2.0e-23 Identity = 54/66 (81.82%), Postives = 60/66 (90.91%), Query Frame = 1
BLAST of CmoCh14G010250 vs. NCBI nr
Match: gi|567893207|ref|XP_006439124.1| (hypothetical protein CICLE_v10033564mg [Citrus clementina]) HSP 1 Score: 114.8 bits (286), Expect = 5.8e-23 Identity = 54/66 (81.82%), Postives = 59/66 (89.39%), Query Frame = 1
BLAST of CmoCh14G010250 vs. NCBI nr
Match: gi|629085464|gb|KCW51821.1| (hypothetical protein EUGRSUZ_J01270 [Eucalyptus grandis]) HSP 1 Score: 114.4 bits (285), Expect = 7.6e-23 Identity = 52/65 (80.00%), Postives = 60/65 (92.31%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |