CmoCh13G004020 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGACTAAGGCTCTTTTCCTTGTGGCTTCTCTTCTCCTCTACGTCCTATCGCTATCGTCCCTCGTAGCGGCAACCCAACGTTTAGATTTGGCTGGTAGCTACAAACCAATAAAAAACATAGATGATCCAAAGATTCAGAGCTTAGGTGAGTTCGCAGTCAATGAACACAATAAACAGGCAAAGACTCAACTCAAGTTCCAAAAAGTGATTAGTGGAGAAATGCAAATTGTGGCCGGGACCAACTATAAACTTCAATTGACAGCTCTTGAGGGGACTAGTAGCGGAACCTATGGCACCCTTGTGTTCACTGACCTCAACAACAAGAACAACCTTATCAACTTCTATGACGTCTCCAAATAG ATGACTAAGGCTCTTTTCCTTGTGGCTTCTCTTCTCCTCTACGTCCTATCGCTATCGTCCCTCGTAGCGGCAACCCAACGTTTAGATTTGGCTGGTAGCTACAAACCAATAAAAAACATAGATGATCCAAAGATTCAGAGCTTAGGTGAGTTCGCAGTCAATGAACACAATAAACAGGCAAAGACTCAACTCAAGTTCCAAAAAGTGATTAGTGGAGAAATGCAAATTGTGGCCGGGACCAACTATAAACTTCAATTGACAGCTCTTGAGGGGACTAGTAGCGGAACCTATGGCACCCTTGTGTTCACTGACCTCAACAACAAGAACAACCTTATCAACTTCTATGACGTCTCCAAATAG ATGACTAAGGCTCTTTTCCTTGTGGCTTCTCTTCTCCTCTACGTCCTATCGCTATCGTCCCTCGTAGCGGCAACCCAACGTTTAGATTTGGCTGGTAGCTACAAACCAATAAAAAACATAGATGATCCAAAGATTCAGAGCTTAGGTGAGTTCGCAGTCAATGAACACAATAAACAGGCAAAGACTCAACTCAAGTTCCAAAAAGTGATTAGTGGAGAAATGCAAATTGTGGCCGGGACCAACTATAAACTTCAATTGACAGCTCTTGAGGGGACTAGTAGCGGAACCTATGGCACCCTTGTGTTCACTGACCTCAACAACAAGAACAACCTTATCAACTTCTATGACGTCTCCAAATAG
BLAST of CmoCh13G004020 vs. Swiss-Prot
Match: CYT1_ACTDE (Cysteine proteinase inhibitor 1 OS=Actinidia deliciosa PE=1 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 1.8e-14 Identity = 38/92 (41.30%), Postives = 64/92 (69.57%), Query Frame = 1
BLAST of CmoCh13G004020 vs. Swiss-Prot
Match: CYT5_ARATH (Cysteine proteinase inhibitor 5 OS=Arabidopsis thaliana GN=CYS5 PE=2 SV=2) HSP 1 Score: 72.4 bits (176), Expect = 3.8e-12 Identity = 38/91 (41.76%), Postives = 62/91 (68.13%), Query Frame = 1
BLAST of CmoCh13G004020 vs. Swiss-Prot
Match: CYT6_ORYSJ (Cysteine proteinase inhibitor 6 OS=Oryza sativa subsp. japonica GN=Os03g0210200 PE=3 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.9e-11 Identity = 40/98 (40.82%), Postives = 60/98 (61.22%), Query Frame = 1
BLAST of CmoCh13G004020 vs. Swiss-Prot
Match: CYT4_ARATH (Cysteine proteinase inhibitor 4 OS=Arabidopsis thaliana GN=CYS4 PE=3 SV=2) HSP 1 Score: 64.3 bits (155), Expect = 1.0e-09 Identity = 35/91 (38.46%), Postives = 59/91 (64.84%), Query Frame = 1
BLAST of CmoCh13G004020 vs. Swiss-Prot
Match: CYT8_ORYSJ (Cysteine proteinase inhibitor 8 OS=Oryza sativa subsp. japonica GN=Os03g0429000 PE=2 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 3.6e-07 Identity = 36/99 (36.36%), Postives = 56/99 (56.57%), Query Frame = 1
BLAST of CmoCh13G004020 vs. TrEMBL
Match: A0A0A0LYM0_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus GN=Csa_1G183070 PE=3 SV=1) HSP 1 Score: 152.5 bits (384), Expect = 3.2e-34 Identity = 80/115 (69.57%), Postives = 97/115 (84.35%), Query Frame = 1
BLAST of CmoCh13G004020 vs. TrEMBL
Match: A0A0A0LT34_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus GN=Csa_1G182070 PE=3 SV=1) HSP 1 Score: 143.7 bits (361), Expect = 1.5e-31 Identity = 77/119 (64.71%), Postives = 96/119 (80.67%), Query Frame = 1
BLAST of CmoCh13G004020 vs. TrEMBL
Match: F6HRK8_VITVI (Cysteine proteinase inhibitor OS=Vitis vinifera GN=VIT_00s0187g00040 PE=3 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 3.3e-15 Identity = 50/98 (51.02%), Postives = 66/98 (67.35%), Query Frame = 1
BLAST of CmoCh13G004020 vs. TrEMBL
Match: A5B2E1_VITVI (Cysteine proteinase inhibitor OS=Vitis vinifera GN=VITISV_013491 PE=3 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 7.4e-15 Identity = 50/98 (51.02%), Postives = 65/98 (66.33%), Query Frame = 1
BLAST of CmoCh13G004020 vs. TrEMBL
Match: A0A075F955_TOBAC (Cysteine proteinase inhibitor OS=Nicotiana tabacum GN=CYS9 PE=2 SV=1) HSP 1 Score: 85.5 bits (210), Expect = 4.8e-14 Identity = 50/114 (43.86%), Postives = 75/114 (65.79%), Query Frame = 1
BLAST of CmoCh13G004020 vs. TAIR10
Match: AT5G47550.1 (AT5G47550.1 Cystatin/monellin superfamily protein) HSP 1 Score: 72.4 bits (176), Expect = 2.1e-13 Identity = 38/91 (41.76%), Postives = 62/91 (68.13%), Query Frame = 1
BLAST of CmoCh13G004020 vs. TAIR10
Match: AT4G16500.1 (AT4G16500.1 Cystatin/monellin superfamily protein) HSP 1 Score: 64.3 bits (155), Expect = 5.8e-11 Identity = 35/91 (38.46%), Postives = 59/91 (64.84%), Query Frame = 1
BLAST of CmoCh13G004020 vs. TAIR10
Match: AT2G40880.1 (AT2G40880.1 cystatin A) HSP 1 Score: 50.4 bits (119), Expect = 8.6e-07 Identity = 34/105 (32.38%), Postives = 57/105 (54.29%), Query Frame = 1
BLAST of CmoCh13G004020 vs. TAIR10
Match: AT5G12140.1 (AT5G12140.1 cystatin-1) HSP 1 Score: 47.8 bits (112), Expect = 5.6e-06 Identity = 20/59 (33.90%), Postives = 38/59 (64.41%), Query Frame = 1
BLAST of CmoCh13G004020 vs. NCBI nr
Match: gi|449467076|ref|XP_004151251.1| (PREDICTED: cysteine proteinase inhibitor 5-like [Cucumis sativus]) HSP 1 Score: 152.5 bits (384), Expect = 4.6e-34 Identity = 80/115 (69.57%), Postives = 97/115 (84.35%), Query Frame = 1
BLAST of CmoCh13G004020 vs. NCBI nr
Match: gi|449467074|ref|XP_004151250.1| (PREDICTED: cysteine proteinase inhibitor 5-like [Cucumis sativus]) HSP 1 Score: 143.7 bits (361), Expect = 2.1e-31 Identity = 77/119 (64.71%), Postives = 96/119 (80.67%), Query Frame = 1
BLAST of CmoCh13G004020 vs. NCBI nr
Match: gi|297741794|emb|CBI33099.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 89.4 bits (220), Expect = 4.7e-15 Identity = 50/98 (51.02%), Postives = 66/98 (67.35%), Query Frame = 1
BLAST of CmoCh13G004020 vs. NCBI nr
Match: gi|359495539|ref|XP_003635016.1| (PREDICTED: cysteine proteinase inhibitor 1-like [Vitis vinifera]) HSP 1 Score: 89.4 bits (220), Expect = 4.7e-15 Identity = 50/98 (51.02%), Postives = 66/98 (67.35%), Query Frame = 1
BLAST of CmoCh13G004020 vs. NCBI nr
Match: gi|147854421|emb|CAN82794.1| (hypothetical protein VITISV_013491 [Vitis vinifera]) HSP 1 Score: 88.2 bits (217), Expect = 1.1e-14 Identity = 50/98 (51.02%), Postives = 65/98 (66.33%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |