CmoCh12G001760 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTGGTGACAGGTGAGCGAGACCCGATGAAGCCCCATGGAGTGAAGCTTCTCGAATCATTTATTGACCCATTAGTAATTTATCATTCTAAAGGCCACATAGTACCTACACTCGGTAATATTTACATTTAATTCACATTTATTTTCTTAATTCTTTATGCTAATTTATATTATATTATCAACCTTATATTTTATATTTTCAGATCACGAAGCTGTGAAGATTATGCAGACTTTCATTCATGTGATTTCAAACACATTCAATGTTTAA ATGGTGGTGACAGGTGAGCGAGACCCGATGAAGCCCCATGGAGTGAAGCTTCTCGAATCATTTATTGACCCATTAGTAATTTATCATTCTAAAGGCCACATAGTACCTACACTCGATCACGAAGCTGTGAAGATTATGCAGACTTTCATTCATGTGATTTCAAACACATTCAATGTTTAA ATGGTGGTGACAGGTGAGCGAGACCCGATGAAGCCCCATGGAGTGAAGCTTCTCGAATCATTTATTGACCCATTAGTAATTTATCATTCTAAAGGCCACATAGTACCTACACTCGATCACGAAGCTGTGAAGATTATGCAGACTTTCATTCATGTGATTTCAAACACATTCAATGTTTAA
BLAST of CmoCh12G001760 vs. TrEMBL
Match: A0A0A0LNX4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G369800 PE=4 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 3.9e-09 Identity = 29/54 (53.70%), Postives = 40/54 (74.07%), Query Frame = 1
BLAST of CmoCh12G001760 vs. TrEMBL
Match: A0A067K402_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_18678 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 1.9e-08 Identity = 29/51 (56.86%), Postives = 38/51 (74.51%), Query Frame = 1
BLAST of CmoCh12G001760 vs. TrEMBL
Match: A0A067L2I6_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_15855 PE=4 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 3.3e-08 Identity = 28/52 (53.85%), Postives = 39/52 (75.00%), Query Frame = 1
BLAST of CmoCh12G001760 vs. TrEMBL
Match: B9T7U6_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0409070 PE=4 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 1.6e-07 Identity = 27/48 (56.25%), Postives = 37/48 (77.08%), Query Frame = 1
BLAST of CmoCh12G001760 vs. TrEMBL
Match: A0A164ZKK9_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_019298 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 4.8e-07 Identity = 25/51 (49.02%), Postives = 37/51 (72.55%), Query Frame = 1
BLAST of CmoCh12G001760 vs. TAIR10
Match: AT5G65400.1 (AT5G65400.1 alpha/beta-Hydrolases superfamily protein) HSP 1 Score: 53.9 bits (128), Expect = 3.9e-08 Identity = 25/49 (51.02%), Postives = 35/49 (71.43%), Query Frame = 1
BLAST of CmoCh12G001760 vs. TAIR10
Match: AT4G24380.1 (AT4G24380.1 INVOLVED IN: 10-formyltetrahydrofolate biosynthetic process, folic acid and derivative biosynthetic process) HSP 1 Score: 53.5 bits (127), Expect = 5.0e-08 Identity = 21/51 (41.18%), Postives = 37/51 (72.55%), Query Frame = 1
BLAST of CmoCh12G001760 vs. NCBI nr
Match: gi|449469815|ref|XP_004152614.1| (PREDICTED: dihydrofolate reductase [Cucumis sativus]) HSP 1 Score: 68.2 bits (165), Expect = 5.6e-09 Identity = 29/54 (53.70%), Postives = 40/54 (74.07%), Query Frame = 1
BLAST of CmoCh12G001760 vs. NCBI nr
Match: gi|643718549|gb|KDP29743.1| (hypothetical protein JCGZ_18678 [Jatropha curcas]) HSP 1 Score: 65.9 bits (159), Expect = 2.8e-08 Identity = 29/51 (56.86%), Postives = 38/51 (74.51%), Query Frame = 1
BLAST of CmoCh12G001760 vs. NCBI nr
Match: gi|802673702|ref|XP_012081637.1| (PREDICTED: UPF0483 protein CBG03338-like [Jatropha curcas]) HSP 1 Score: 65.9 bits (159), Expect = 2.8e-08 Identity = 29/51 (56.86%), Postives = 38/51 (74.51%), Query Frame = 1
BLAST of CmoCh12G001760 vs. NCBI nr
Match: gi|659088253|ref|XP_008444882.1| (PREDICTED: dihydrofolate reductase-like [Cucumis melo]) HSP 1 Score: 65.1 bits (157), Expect = 4.7e-08 Identity = 28/54 (51.85%), Postives = 39/54 (72.22%), Query Frame = 1
BLAST of CmoCh12G001760 vs. NCBI nr
Match: gi|802570016|ref|XP_012067951.1| (PREDICTED: UPF0483 protein AGAP003155 [Jatropha curcas]) HSP 1 Score: 65.1 bits (157), Expect = 4.7e-08 Identity = 28/52 (53.85%), Postives = 39/52 (75.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |