CmoCh11G013820 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAAACAATGAAGCTCTGCCTCTTTCTCCTTCTAGTCTTCGCCACCGTTTCTCCTCCATTCTCCTTTGCCTTCCATGAAACCTCCGACGGTTCATCCGCTTTCGACTATAGTTCCCAATACAGTTTTTTTGGTGGAGACTCTTCGGAAGCGATCACTGAAGATAGTCGGCGACAACTTTTCCAATATGGATTTGCCTATAATAGGGAAGCTCGCAGGAGGTTTTTGACCTACTATGCACTTAGTAAGAATAATATCCCTTGTGGCCGTCGTGGTACCTCCTACTATGATTGCAAGAAGCGTAGAAGGATCAATCCTTATCGTCGCGGTTGTGCCGCCATCACTGGATGTGCTCGATTTACCGATTAA ATGGAAACAATGAAGCTCTGCCTCTTTCTCCTTCTAGTCTTCGCCACCGTTTCTCCTCCATTCTCCTTTGCCTTCCATGAAACCTCCGACGGTTCATCCGCTTTCGACTATAGTTCCCAATACAGTTTTTTTGGTGGAGACTCTTCGGAAGCGATCACTGAAGATAGTCGGCGACAACTTTTCCAATATGGATTTGCCTATAATAGGGAAGCTCGCAGGAGGTTTTTGACCTACTATGCACTTAGTAAGAATAATATCCCTTGTGGCCGTCGTGGTACCTCCTACTATGATTGCAAGAAGCGTAGAAGGATCAATCCTTATCGTCGCGGTTGTGCCGCCATCACTGGATGTGCTCGATTTACCGATTAA ATGGAAACAATGAAGCTCTGCCTCTTTCTCCTTCTAGTCTTCGCCACCGTTTCTCCTCCATTCTCCTTTGCCTTCCATGAAACCTCCGACGGTTCATCCGCTTTCGACTATAGTTCCCAATACAGTTTTTTTGGTGGAGACTCTTCGGAAGCGATCACTGAAGATAGTCGGCGACAACTTTTCCAATATGGATTTGCCTATAATAGGGAAGCTCGCAGGAGGTTTTTGACCTACTATGCACTTAGTAAGAATAATATCCCTTGTGGCCGTCGTGGTACCTCCTACTATGATTGCAAGAAGCGTAGAAGGATCAATCCTTATCGTCGCGGTTGTGCCGCCATCACTGGATGTGCTCGATTTACCGATTAA
BLAST of CmoCh11G013820 vs. Swiss-Prot
Match: RLF19_ARATH (Protein RALF-like 19 OS=Arabidopsis thaliana GN=RALFL19 PE=3 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 3.7e-15 Identity = 40/69 (57.97%), Postives = 48/69 (69.57%), Query Frame = 1
BLAST of CmoCh11G013820 vs. Swiss-Prot
Match: RLF4_ARATH (Protein RALF-like 4 OS=Arabidopsis thaliana GN=RALFL4 PE=3 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 2.7e-13 Identity = 51/122 (41.80%), Postives = 67/122 (54.92%), Query Frame = 1
BLAST of CmoCh11G013820 vs. Swiss-Prot
Match: RALF_TOBAC (Rapid alkalinization factor OS=Nicotiana tabacum GN=RALF PE=1 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 4.7e-10 Identity = 33/74 (44.59%), Postives = 45/74 (60.81%), Query Frame = 1
BLAST of CmoCh11G013820 vs. Swiss-Prot
Match: RLF23_ARATH (Rapid alkalinization factor 23 OS=Arabidopsis thaliana GN=RALF23 PE=1 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 1.0e-09 Identity = 43/111 (38.74%), Postives = 55/111 (49.55%), Query Frame = 1
BLAST of CmoCh11G013820 vs. Swiss-Prot
Match: RLF22_ARATH (Protein RALF-like 22 OS=Arabidopsis thaliana GN=RALFL22 PE=3 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 1.0e-09 Identity = 35/101 (34.65%), Postives = 57/101 (56.44%), Query Frame = 1
BLAST of CmoCh11G013820 vs. TrEMBL
Match: A0A0A0KHU4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G484570 PE=4 SV=1) HSP 1 Score: 114.4 bits (285), Expect = 9.8e-23 Identity = 66/122 (54.10%), Postives = 80/122 (65.57%), Query Frame = 1
BLAST of CmoCh11G013820 vs. TrEMBL
Match: A0A0A0KCD7_CUCSA (F3H9.8 protein OS=Cucumis sativus GN=Csa_6G199790 PE=4 SV=1) HSP 1 Score: 101.7 bits (252), Expect = 6.6e-19 Identity = 63/121 (52.07%), Postives = 77/121 (63.64%), Query Frame = 1
BLAST of CmoCh11G013820 vs. TrEMBL
Match: R0HVQ3_9BRAS (Uncharacterized protein OS=Capsella rubella GN=CARUB_v10024364mg PE=4 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 8.3e-14 Identity = 41/69 (59.42%), Postives = 49/69 (71.01%), Query Frame = 1
BLAST of CmoCh11G013820 vs. TrEMBL
Match: A0A078FRQ3_BRANA (BnaA05g09880D protein OS=Brassica napus GN=BnaA05g09880D PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.9e-13 Identity = 40/69 (57.97%), Postives = 48/69 (69.57%), Query Frame = 1
BLAST of CmoCh11G013820 vs. TrEMBL
Match: M4CMN5_BRARP (Uncharacterized protein OS=Brassica rapa subsp. pekinensis PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.9e-13 Identity = 40/69 (57.97%), Postives = 48/69 (69.57%), Query Frame = 1
BLAST of CmoCh11G013820 vs. TAIR10
Match: AT2G33775.1 (AT2G33775.1 ralf-like 19) HSP 1 Score: 82.4 bits (202), Expect = 2.1e-16 Identity = 40/69 (57.97%), Postives = 48/69 (69.57%), Query Frame = 1
BLAST of CmoCh11G013820 vs. TAIR10
Match: AT1G28270.1 (AT1G28270.1 ralf-like 4) HSP 1 Score: 76.3 bits (186), Expect = 1.5e-14 Identity = 51/122 (41.80%), Postives = 67/122 (54.92%), Query Frame = 1
BLAST of CmoCh11G013820 vs. TAIR10
Match: AT3G16570.1 (AT3G16570.1 rapid alkalinization factor 23) HSP 1 Score: 64.3 bits (155), Expect = 5.9e-11 Identity = 43/111 (38.74%), Postives = 55/111 (49.55%), Query Frame = 1
BLAST of CmoCh11G013820 vs. TAIR10
Match: AT3G05490.1 (AT3G05490.1 ralf-like 22) HSP 1 Score: 64.3 bits (155), Expect = 5.9e-11 Identity = 35/101 (34.65%), Postives = 57/101 (56.44%), Query Frame = 1
BLAST of CmoCh11G013820 vs. TAIR10
Match: AT1G02900.1 (AT1G02900.1 rapid alkalinization factor 1) HSP 1 Score: 59.7 bits (143), Expect = 1.5e-09 Identity = 39/123 (31.71%), Postives = 61/123 (49.59%), Query Frame = 1
BLAST of CmoCh11G013820 vs. NCBI nr
Match: gi|449461879|ref|XP_004148669.1| (PREDICTED: protein RALF-like 19 [Cucumis sativus]) HSP 1 Score: 114.4 bits (285), Expect = 1.4e-22 Identity = 66/122 (54.10%), Postives = 80/122 (65.57%), Query Frame = 1
BLAST of CmoCh11G013820 vs. NCBI nr
Match: gi|659080853|ref|XP_008441015.1| (PREDICTED: protein RALF-like 19 [Cucumis melo]) HSP 1 Score: 110.2 bits (274), Expect = 2.7e-21 Identity = 67/122 (54.92%), Postives = 81/122 (66.39%), Query Frame = 1
BLAST of CmoCh11G013820 vs. NCBI nr
Match: gi|449466199|ref|XP_004150814.1| (PREDICTED: protein RALF-like 4 [Cucumis sativus]) HSP 1 Score: 101.7 bits (252), Expect = 9.5e-19 Identity = 63/121 (52.07%), Postives = 77/121 (63.64%), Query Frame = 1
BLAST of CmoCh11G013820 vs. NCBI nr
Match: gi|1009109354|ref|XP_015889777.1| (PREDICTED: protein RALF-like 19 [Ziziphus jujuba]) HSP 1 Score: 94.0 bits (232), Expect = 2.0e-16 Identity = 54/120 (45.00%), Postives = 72/120 (60.00%), Query Frame = 1
BLAST of CmoCh11G013820 vs. NCBI nr
Match: gi|729376459|ref|XP_010549330.1| (PREDICTED: protein RALF-like 19 [Tarenaya hassleriana]) HSP 1 Score: 86.7 bits (213), Expect = 3.2e-14 Identity = 40/69 (57.97%), Postives = 51/69 (73.91%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |