CmoCh11G013810 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAAACTGTGAAGCTCTGCCTCTTTCTCCTCTTCGTCTTGGCTGTCGTTGCTCCTCCACTCTCCTTTGCCTACCATGAAACCTCCAACGATTCATCTTACGTCAACGATATTTCTAAATACAGCTTCTTTGGCGGAGACTCCTCGGAAGCCATGACTGAAGATAGTCGGCGACAACTTTTCCAATATGGATTCGCTTATAATAAGGAAGCTCGCAGGAGGTTTTTGACCTACTATGCACTTAGTAAGAATAATATCCCTTGCGGCCGTCGTGGTACCTCCTACTATGATTGCAAGAAGCGTAGAAGGATCAATCCTTATCGTCGTGGTTGTGCTGCCATCACTGGATGTGCTCGATTCACCGATTAA ATGGAAACTGTGAAGCTCTGCCTCTTTCTCCTCTTCGTCTTGGCTGTCGTTGCTCCTCCACTCTCCTTTGCCTACCATGAAACCTCCAACGATTCATCTTACGTCAACGATATTTCTAAATACAGCTTCTTTGGCGGAGACTCCTCGGAAGCCATGACTGAAGATAGTCGGCGACAACTTTTCCAATATGGATTCGCTTATAATAAGGAAGCTCGCAGGAGGTTTTTGACCTACTATGCACTTAGTAAGAATAATATCCCTTGCGGCCGTCGTGGTACCTCCTACTATGATTGCAAGAAGCGTAGAAGGATCAATCCTTATCGTCGTGGTTGTGCTGCCATCACTGGATGTGCTCGATTCACCGATTAA ATGGAAACTGTGAAGCTCTGCCTCTTTCTCCTCTTCGTCTTGGCTGTCGTTGCTCCTCCACTCTCCTTTGCCTACCATGAAACCTCCAACGATTCATCTTACGTCAACGATATTTCTAAATACAGCTTCTTTGGCGGAGACTCCTCGGAAGCCATGACTGAAGATAGTCGGCGACAACTTTTCCAATATGGATTCGCTTATAATAAGGAAGCTCGCAGGAGGTTTTTGACCTACTATGCACTTAGTAAGAATAATATCCCTTGCGGCCGTCGTGGTACCTCCTACTATGATTGCAAGAAGCGTAGAAGGATCAATCCTTATCGTCGTGGTTGTGCTGCCATCACTGGATGTGCTCGATTCACCGATTAA
BLAST of CmoCh11G013810 vs. Swiss-Prot
Match: RLF4_ARATH (Protein RALF-like 4 OS=Arabidopsis thaliana GN=RALFL4 PE=3 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 4.9e-15 Identity = 52/117 (44.44%), Postives = 70/117 (59.83%), Query Frame = 1
BLAST of CmoCh11G013810 vs. Swiss-Prot
Match: RLF19_ARATH (Protein RALF-like 19 OS=Arabidopsis thaliana GN=RALFL19 PE=3 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 5.4e-14 Identity = 54/119 (45.38%), Postives = 66/119 (55.46%), Query Frame = 1
BLAST of CmoCh11G013810 vs. Swiss-Prot
Match: RLF23_ARATH (Rapid alkalinization factor 23 OS=Arabidopsis thaliana GN=RALF23 PE=1 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 3.6e-10 Identity = 38/91 (41.76%), Postives = 51/91 (56.04%), Query Frame = 1
BLAST of CmoCh11G013810 vs. Swiss-Prot
Match: RALF_TOBAC (Rapid alkalinization factor OS=Nicotiana tabacum GN=RALF PE=1 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 6.1e-10 Identity = 26/47 (55.32%), Postives = 36/47 (76.60%), Query Frame = 1
BLAST of CmoCh11G013810 vs. Swiss-Prot
Match: RLF22_ARATH (Protein RALF-like 22 OS=Arabidopsis thaliana GN=RALFL22 PE=3 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 5.2e-09 Identity = 29/81 (35.80%), Postives = 50/81 (61.73%), Query Frame = 1
BLAST of CmoCh11G013810 vs. TrEMBL
Match: A0A0A0KHU4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G484570 PE=4 SV=1) HSP 1 Score: 121.3 bits (303), Expect = 8.0e-25 Identity = 70/122 (57.38%), Postives = 80/122 (65.57%), Query Frame = 1
BLAST of CmoCh11G013810 vs. TrEMBL
Match: A0A0A0KCD7_CUCSA (F3H9.8 protein OS=Cucumis sativus GN=Csa_6G199790 PE=4 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 1.7e-19 Identity = 63/121 (52.07%), Postives = 78/121 (64.46%), Query Frame = 1
BLAST of CmoCh11G013810 vs. TrEMBL
Match: A0A078FS15_BRANA (BnaA07g08550D protein OS=Brassica napus GN=BnaA07g08550D PE=4 SV=1) HSP 1 Score: 84.3 bits (207), Expect = 1.1e-13 Identity = 54/122 (44.26%), Postives = 70/122 (57.38%), Query Frame = 1
BLAST of CmoCh11G013810 vs. TrEMBL
Match: A0A087HRE6_ARAAL (Uncharacterized protein OS=Arabis alpina GN=AALP_AA1G291600 PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.9e-13 Identity = 54/118 (45.76%), Postives = 68/118 (57.63%), Query Frame = 1
BLAST of CmoCh11G013810 vs. TrEMBL
Match: M4EMR1_BRARP (Uncharacterized protein OS=Brassica rapa subsp. pekinensis PE=4 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 2.4e-13 Identity = 41/70 (58.57%), Postives = 49/70 (70.00%), Query Frame = 1
BLAST of CmoCh11G013810 vs. TAIR10
Match: AT1G28270.1 (AT1G28270.1 ralf-like 4) HSP 1 Score: 82.0 bits (201), Expect = 2.7e-16 Identity = 52/117 (44.44%), Postives = 70/117 (59.83%), Query Frame = 1
BLAST of CmoCh11G013810 vs. TAIR10
Match: AT2G33775.1 (AT2G33775.1 ralf-like 19) HSP 1 Score: 78.6 bits (192), Expect = 3.0e-15 Identity = 54/119 (45.38%), Postives = 66/119 (55.46%), Query Frame = 1
BLAST of CmoCh11G013810 vs. TAIR10
Match: AT3G16570.1 (AT3G16570.1 rapid alkalinization factor 23) HSP 1 Score: 65.9 bits (159), Expect = 2.0e-11 Identity = 38/91 (41.76%), Postives = 51/91 (56.04%), Query Frame = 1
BLAST of CmoCh11G013810 vs. TAIR10
Match: AT3G05490.1 (AT3G05490.1 ralf-like 22) HSP 1 Score: 62.0 bits (149), Expect = 2.9e-10 Identity = 29/81 (35.80%), Postives = 50/81 (61.73%), Query Frame = 1
BLAST of CmoCh11G013810 vs. TAIR10
Match: AT4G15800.1 (AT4G15800.1 ralf-like 33) HSP 1 Score: 60.5 bits (145), Expect = 8.5e-10 Identity = 35/109 (32.11%), Postives = 59/109 (54.13%), Query Frame = 1
BLAST of CmoCh11G013810 vs. NCBI nr
Match: gi|449461879|ref|XP_004148669.1| (PREDICTED: protein RALF-like 19 [Cucumis sativus]) HSP 1 Score: 121.3 bits (303), Expect = 1.2e-24 Identity = 70/122 (57.38%), Postives = 80/122 (65.57%), Query Frame = 1
BLAST of CmoCh11G013810 vs. NCBI nr
Match: gi|659080853|ref|XP_008441015.1| (PREDICTED: protein RALF-like 19 [Cucumis melo]) HSP 1 Score: 117.5 bits (293), Expect = 1.7e-23 Identity = 70/122 (57.38%), Postives = 82/122 (67.21%), Query Frame = 1
BLAST of CmoCh11G013810 vs. NCBI nr
Match: gi|449466199|ref|XP_004150814.1| (PREDICTED: protein RALF-like 4 [Cucumis sativus]) HSP 1 Score: 103.6 bits (257), Expect = 2.5e-19 Identity = 63/121 (52.07%), Postives = 78/121 (64.46%), Query Frame = 1
BLAST of CmoCh11G013810 vs. NCBI nr
Match: gi|1009109354|ref|XP_015889777.1| (PREDICTED: protein RALF-like 19 [Ziziphus jujuba]) HSP 1 Score: 98.2 bits (243), Expect = 1.0e-17 Identity = 57/120 (47.50%), Postives = 74/120 (61.67%), Query Frame = 1
BLAST of CmoCh11G013810 vs. NCBI nr
Match: gi|729376459|ref|XP_010549330.1| (PREDICTED: protein RALF-like 19 [Tarenaya hassleriana]) HSP 1 Score: 85.1 bits (209), Expect = 9.2e-14 Identity = 52/116 (44.83%), Postives = 69/116 (59.48%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |