CmoCh09G012250 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGTTCTCTACCTTGGAGGAATAGAAGTTTTGCAAATTCAAGAGAAGATCATGGTGAGATGAGACAGATCAACATGACCTGATCAAACCATTGTAACTCTTTGACAACACGAAAAAAACCATTGTAACTCTTTTGACAACACGAAAAAAACCATTGTAACTCTTTGACAACACGAAAAAACCATTGTTCAACTCTTTGACAACACGAAAAAAAAATCATTGTTCAACTCTTTGACAACACGAAAAAAAAAATCATTGTTCAACTCTTTGACAGCACGAAAAAAAACCATTGTTCTCTTTGACAACACGAAAAAAAACCACCATTGTTCTCTTTGACAACACGAAAAAAACTATTGTTCTCTTTGACAACACGAAAAAAACCATTGTTCTCTTTGACAACACGAAAAAAACCATTGTTCAACTCTTTAACAACACGAAAAAAACCATTATCAACTCTTTGACAACACGAAAAAAAACCATTATCAACTCTTTGACAACACGAAAAAAAACCATTATCTTGACAACACGAAAAAAACCATTGTCAACTCTTTAACAACACGAAAAAAAAACCATTGTCAACTCTTTAACAACACGAAAAAAAAAACCATTGTCAGATGCGGAGAAGGCTAGTGACATTGATCCACAAGAAGCTCAGCAAACTCTTGAAATAGCGGAAGTTAACTTGAGGAAAGCTCAGGACAAGAGACAAACAATCGAGGCAAATTTAGCTCTCAAACGAGCTAGGACACGAGTAGAGGCTATCAATGGCGTACCTAGTTGA ATGGGTTCTCTACCTTGGAGGAATAGAAGTTTTGCAAATTCAAGAGAAGATCATGATGCGGAGAAGGCTAGTGACATTGATCCACAAGAAGCTCAGCAAACTCTTGAAATAGCGGAAGTTAACTTGAGGAAAGCTCAGGACAAGAGACAAACAATCGAGGCAAATTTAGCTCTCAAACGAGCTAGGACACGAGTAGAGGCTATCAATGGCGTACCTAGTTGA ATGGGTTCTCTACCTTGGAGGAATAGAAGTTTTGCAAATTCAAGAGAAGATCATGATGCGGAGAAGGCTAGTGACATTGATCCACAAGAAGCTCAGCAAACTCTTGAAATAGCGGAAGTTAACTTGAGGAAAGCTCAGGACAAGAGACAAACAATCGAGGCAAATTTAGCTCTCAAACGAGCTAGGACACGAGTAGAGGCTATCAATGGCGTACCTAGTTGA
BLAST of CmoCh09G012250 vs. Swiss-Prot
Match: ATPE_CUCSA (ATP synthase epsilon chain, chloroplastic OS=Cucumis sativus GN=atpE PE=3 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.5e-19 Identity = 52/56 (92.86%), Postives = 54/56 (96.43%), Query Frame = 1
BLAST of CmoCh09G012250 vs. Swiss-Prot
Match: ATPE_COFAR (ATP synthase epsilon chain, chloroplastic OS=Coffea arabica GN=atpE PE=3 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 2.0e-16 Identity = 46/54 (85.19%), Postives = 50/54 (92.59%), Query Frame = 1
BLAST of CmoCh09G012250 vs. Swiss-Prot
Match: ATPE_CITSI (ATP synthase epsilon chain, chloroplastic OS=Citrus sinensis GN=atpE PE=3 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 2.0e-16 Identity = 45/54 (83.33%), Postives = 50/54 (92.59%), Query Frame = 1
BLAST of CmoCh09G012250 vs. Swiss-Prot
Match: ATPE_EUCGG (ATP synthase epsilon chain, chloroplastic OS=Eucalyptus globulus subsp. globulus GN=atpE PE=3 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 4.5e-16 Identity = 44/54 (81.48%), Postives = 50/54 (92.59%), Query Frame = 1
BLAST of CmoCh09G012250 vs. Swiss-Prot
Match: ATPE_GOSHI (ATP synthase epsilon chain, chloroplastic OS=Gossypium hirsutum GN=atpE PE=3 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 4.5e-16 Identity = 45/54 (83.33%), Postives = 49/54 (90.74%), Query Frame = 1
BLAST of CmoCh09G012250 vs. TrEMBL
Match: G9HXF0_CITLA (ATP synthase epsilon chain, chloroplastic OS=Citrullus lanatus GN=atpE PE=3 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.7e-17 Identity = 52/56 (92.86%), Postives = 54/56 (96.43%), Query Frame = 1
BLAST of CmoCh09G012250 vs. TrEMBL
Match: A0A0S2IG13_CUCPE (AtpE OS=Cucurbita pepo subsp. fraterna GN=atpE PE=3 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.7e-17 Identity = 52/56 (92.86%), Postives = 54/56 (96.43%), Query Frame = 1
BLAST of CmoCh09G012250 vs. TrEMBL
Match: A0A0S2IGL3_CUCPE (AtpE OS=Cucurbita pepo var. ozarkana GN=atpE PE=3 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.7e-17 Identity = 52/56 (92.86%), Postives = 54/56 (96.43%), Query Frame = 1
BLAST of CmoCh09G012250 vs. TrEMBL
Match: A0A0S2IDX1_9ROSI (AtpE OS=Cucurbita argyrosperma GN=atpE PE=3 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.7e-17 Identity = 52/56 (92.86%), Postives = 54/56 (96.43%), Query Frame = 1
BLAST of CmoCh09G012250 vs. TrEMBL
Match: A0A0S2IFH2_9ROSI (AtpE OS=Cucurbita andreana GN=atpE PE=3 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.7e-17 Identity = 52/56 (92.86%), Postives = 54/56 (96.43%), Query Frame = 1
BLAST of CmoCh09G012250 vs. TAIR10
Match: ATCG00470.1 (ATCG00470.1 ATP synthase epsilon chain) HSP 1 Score: 84.3 bits (207), Expect = 3.3e-17 Identity = 45/54 (83.33%), Postives = 50/54 (92.59%), Query Frame = 1
BLAST of CmoCh09G012250 vs. NCBI nr
Match: gi|952954489|gb|ALO21851.1| (AtpE (plastid) [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 96.3 bits (238), Expect = 2.4e-17 Identity = 52/56 (92.86%), Postives = 54/56 (96.43%), Query Frame = 1
BLAST of CmoCh09G012250 vs. NCBI nr
Match: gi|68164809|ref|YP_247605.1| (ATP synthase CF1 epsilon subunit [Cucumis sativus]) HSP 1 Score: 96.3 bits (238), Expect = 2.4e-17 Identity = 52/56 (92.86%), Postives = 54/56 (96.43%), Query Frame = 1
BLAST of CmoCh09G012250 vs. NCBI nr
Match: gi|952954676|gb|ALO22035.1| (AtpE (plastid) [Cucurbita ecuadorensis]) HSP 1 Score: 96.3 bits (238), Expect = 2.4e-17 Identity = 52/56 (92.86%), Postives = 54/56 (96.43%), Query Frame = 1
BLAST of CmoCh09G012250 vs. NCBI nr
Match: gi|952954770|gb|ALO22128.1| (AtpE (plastid) [Cucurbita ficifolia]) HSP 1 Score: 96.3 bits (238), Expect = 2.4e-17 Identity = 52/56 (92.86%), Postives = 54/56 (96.43%), Query Frame = 1
BLAST of CmoCh09G012250 vs. NCBI nr
Match: gi|952955568|gb|ALO22914.1| (AtpE (plastid) [Cucurbita pedatifolia]) HSP 1 Score: 96.3 bits (238), Expect = 2.4e-17 Identity = 52/56 (92.86%), Postives = 54/56 (96.43%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|