CmoCh08G002830 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCAGTCGCGAACCTCCACAGGTTCCGCCAAATCCACCGTCTGCCGGCGATTAGCTACTCCATTTTCACAAGAGGCTCAGCGTCGGCCGTCGCCTCGTCGGAAACCCCATCGTCCTCGTCCAAAAAGGTGTCAGATCGCATCGTCAAACTGTTCGCGATTGATCCGGAGGGCACGAAGAAGGAGATTGTCGGATTGACCGGCCAGACTCTTCTGAAGGCGCTCGCTAATCGGGGTCTGATTGACCCCGAATCCCATCGATTGGAAGACATCAGCGCGTGTTCGGCCGAATGCGAGGTCAGTATTGCTCAGGAGTGGCTCGAGAAGCTGCCGCCGCGGTCCTACGATGAGGAGTATGTGCTGAAGAGAAATTCTAGGGTTAGGGCTTTGAACAAGCACTCGAGGCTGGGCTGCCAGGTTATTCTCACCCCCGACCTTCAAGGTATGGTTGTTGCTGTCCCCGAGCCCAAACCTTGGGAGATTCCTTAA ATGGCAGTCGCGAACCTCCACAGGTTCCGCCAAATCCACCGTCTGCCGGCGATTAGCTACTCCATTTTCACAAGAGGCTCAGCGTCGGCCGTCGCCTCGTCGGAAACCCCATCGTCCTCGTCCAAAAAGGTGTCAGATCGCATCGTCAAACTGTTCGCGATTGATCCGGAGGGCACGAAGAAGGAGATTGTCGGATTGACCGGCCAGACTCTTCTGAAGGCGCTCGCTAATCGGGGTCTGATTGACCCCGAATCCCATCGATTGGAAGACATCAGCGCGTGTTCGGCCGAATGCGAGGTCAGTATTGCTCAGGAGTGGCTCGAGAAGCTGCCGCCGCGGTCCTACGATGAGGAGTATGTGCTGAAGAGAAATTCTAGGGTTAGGGCTTTGAACAAGCACTCGAGGCTGGGCTGCCAGGTTATTCTCACCCCCGACCTTCAAGGTATGGTTGTTGCTGTCCCCGAGCCCAAACCTTGGGAGATTCCTTAA ATGGCAGTCGCGAACCTCCACAGGTTCCGCCAAATCCACCGTCTGCCGGCGATTAGCTACTCCATTTTCACAAGAGGCTCAGCGTCGGCCGTCGCCTCGTCGGAAACCCCATCGTCCTCGTCCAAAAAGGTGTCAGATCGCATCGTCAAACTGTTCGCGATTGATCCGGAGGGCACGAAGAAGGAGATTGTCGGATTGACCGGCCAGACTCTTCTGAAGGCGCTCGCTAATCGGGGTCTGATTGACCCCGAATCCCATCGATTGGAAGACATCAGCGCGTGTTCGGCCGAATGCGAGGTCAGTATTGCTCAGGAGTGGCTCGAGAAGCTGCCGCCGCGGTCCTACGATGAGGAGTATGTGCTGAAGAGAAATTCTAGGGTTAGGGCTTTGAACAAGCACTCGAGGCTGGGCTGCCAGGTTATTCTCACCCCCGACCTTCAAGGTATGGTTGTTGCTGTCCCCGAGCCCAAACCTTGGGAGATTCCTTAA
BLAST of CmoCh08G002830 vs. Swiss-Prot
Match: ADXL_MOUSE (Adrenodoxin-like protein, mitochondrial OS=Mus musculus GN=Fdx1l PE=1 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 5.0e-07 Identity = 38/118 (32.20%), Postives = 64/118 (54.24%), Query Frame = 1
BLAST of CmoCh08G002830 vs. Swiss-Prot
Match: ADXL_HUMAN (Adrenodoxin-like protein, mitochondrial OS=Homo sapiens GN=FDX1L PE=1 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 5.0e-07 Identity = 36/108 (33.33%), Postives = 58/108 (53.70%), Query Frame = 1
BLAST of CmoCh08G002830 vs. Swiss-Prot
Match: THCC_RHOER (Rhodocoxin OS=Rhodococcus erythropolis GN=thcC PE=1 SV=2) HSP 1 Score: 55.1 bits (131), Expect = 8.4e-07 Identity = 32/102 (31.37%), Postives = 55/102 (53.92%), Query Frame = 1
BLAST of CmoCh08G002830 vs. Swiss-Prot
Match: ADXL_BOVIN (Adrenodoxin-like protein, mitochondrial OS=Bos taurus GN=FDX1L PE=2 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 1.1e-06 Identity = 44/140 (31.43%), Postives = 70/140 (50.00%), Query Frame = 1
BLAST of CmoCh08G002830 vs. Swiss-Prot
Match: ADXH_DROME (Adrenodoxin-like protein, mitochondrial OS=Drosophila melanogaster GN=Fdxh PE=2 SV=3) HSP 1 Score: 53.1 bits (126), Expect = 3.2e-06 Identity = 35/113 (30.97%), Postives = 61/113 (53.98%), Query Frame = 1
BLAST of CmoCh08G002830 vs. TrEMBL
Match: A0A0A0K8M3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G374650 PE=4 SV=1) HSP 1 Score: 265.4 bits (677), Expect = 4.6e-68 Identity = 136/164 (82.93%), Postives = 145/164 (88.41%), Query Frame = 1
BLAST of CmoCh08G002830 vs. TrEMBL
Match: W9R7K3_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_007445 PE=4 SV=1) HSP 1 Score: 250.8 bits (639), Expect = 1.2e-63 Identity = 132/169 (78.11%), Postives = 147/169 (86.98%), Query Frame = 1
BLAST of CmoCh08G002830 vs. TrEMBL
Match: A0A0D2QTR6_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_007G160300 PE=4 SV=1) HSP 1 Score: 234.6 bits (597), Expect = 8.7e-59 Identity = 119/163 (73.01%), Postives = 137/163 (84.05%), Query Frame = 1
BLAST of CmoCh08G002830 vs. TrEMBL
Match: A0A067L9X6_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_15101 PE=4 SV=1) HSP 1 Score: 233.8 bits (595), Expect = 1.5e-58 Identity = 122/166 (73.49%), Postives = 139/166 (83.73%), Query Frame = 1
BLAST of CmoCh08G002830 vs. TrEMBL
Match: M5VL60_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa012572mg PE=4 SV=1) HSP 1 Score: 231.9 bits (590), Expect = 5.6e-58 Identity = 118/165 (71.52%), Postives = 137/165 (83.03%), Query Frame = 1
BLAST of CmoCh08G002830 vs. TAIR10
Match: AT3G07480.1 (AT3G07480.1 2Fe-2S ferredoxin-like superfamily protein) HSP 1 Score: 217.2 bits (552), Expect = 7.2e-57 Identity = 109/152 (71.71%), Postives = 128/152 (84.21%), Query Frame = 1
BLAST of CmoCh08G002830 vs. NCBI nr
Match: gi|449462439|ref|XP_004148948.1| (PREDICTED: adrenodoxin-like protein, mitochondrial [Cucumis sativus]) HSP 1 Score: 265.4 bits (677), Expect = 6.6e-68 Identity = 136/164 (82.93%), Postives = 145/164 (88.41%), Query Frame = 1
BLAST of CmoCh08G002830 vs. NCBI nr
Match: gi|659100696|ref|XP_008451222.1| (PREDICTED: adrenodoxin-like protein, mitochondrial [Cucumis melo]) HSP 1 Score: 265.4 bits (677), Expect = 6.6e-68 Identity = 134/164 (81.71%), Postives = 147/164 (89.63%), Query Frame = 1
BLAST of CmoCh08G002830 vs. NCBI nr
Match: gi|703095680|ref|XP_010095605.1| (hypothetical protein L484_007445 [Morus notabilis]) HSP 1 Score: 250.8 bits (639), Expect = 1.7e-63 Identity = 132/169 (78.11%), Postives = 147/169 (86.98%), Query Frame = 1
BLAST of CmoCh08G002830 vs. NCBI nr
Match: gi|1009151699|ref|XP_015893689.1| (PREDICTED: putidaredoxin-like [Ziziphus jujuba]) HSP 1 Score: 244.2 bits (622), Expect = 1.6e-61 Identity = 128/168 (76.19%), Postives = 145/168 (86.31%), Query Frame = 1
BLAST of CmoCh08G002830 vs. NCBI nr
Match: gi|1009151486|ref|XP_015893575.1| (PREDICTED: putidaredoxin-like [Ziziphus jujuba]) HSP 1 Score: 243.8 bits (621), Expect = 2.0e-61 Identity = 128/168 (76.19%), Postives = 144/168 (85.71%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|