CmoCh07G011180 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonfive_prime_UTRCDS Hold the cursor over a type above to highlight its positions in the sequence below.GCTTGTATCCAGTAGAGGGAGAGAAAGAGAGGGGTAAATGGGTATAATAATTCGAGTTTTGGTTCTCGTGGCCTGTATTTTCCCAGCTTTCATCGAATGCCGAGTTCAACGCTACACGTTTGATGTAAGTACTGATTCTTTTATACCAATCACAAGCAGATGGCAAGACTATCTAACACTCACAATTCCCAGCTTTGTTTTTTTTCTCTTCTTGTTCACTTTTGTACTCGAAAGTGTGTTTTGTTTTTATGGCAAACTTGGTTTCTGATCTTTCATTTTAGCTGACCCATCAGTGTTCTTAACTAAGACAAATCAGACCTTTTGGGGATTCAAATTCCTATTCTATATGTTAATGGCAGGTGGTTTTGAAAAATACTACAAAACTATGTTCGAGTAAGCAAATCGTCACGGTTAATGGAAAGTTTCCAGGGCCGACCATCTACGCTAGGGAAGATGACACAGTACTCATTAAGGTTGTTAACCATGTTCAATACAACCTTTCTATTCACTGGTAA GCTTGTATCCAGTAGAGGGAGAGAAAGAGAGGGGTAAATGGGTATAATAATTCGAGTTTTGGTTCTCGTGGCCTGTATTTTCCCAGCTTTCATCGAATGCCGAGTTCAACGCTACACGTTTGATGTGGTTTTGAAAAATACTACAAAACTATGTTCGAGTAAGCAAATCGTCACGGTTAATGGAAAGTTTCCAGGGCCGACCATCTACGCTAGGGAAGATGACACAGTACTCATTAAGGTTGTTAACCATGTTCAATACAACCTTTCTATTCACTGGTAA ATGGGTATAATAATTCGAGTTTTGGTTCTCGTGGCCTGTATTTTCCCAGCTTTCATCGAATGCCGAGTTCAACGCTACACGTTTGATGTGGTTTTGAAAAATACTACAAAACTATGTTCGAGTAAGCAAATCGTCACGGTTAATGGAAAGTTTCCAGGGCCGACCATCTACGCTAGGGAAGATGACACAGTACTCATTAAGGTTGTTAACCATGTTCAATACAACCTTTCTATTCACTGGTAA
BLAST of CmoCh07G011180 vs. Swiss-Prot
Match: LAC10_ARATH (Laccase-10 OS=Arabidopsis thaliana GN=LAC10 PE=2 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 5.4e-23 Identity = 50/77 (64.94%), Postives = 65/77 (84.42%), Query Frame = 1
BLAST of CmoCh07G011180 vs. Swiss-Prot
Match: LAC4_ARATH (Laccase-4 OS=Arabidopsis thaliana GN=IRX12 PE=2 SV=2) HSP 1 Score: 106.7 bits (265), Expect = 1.2e-22 Identity = 50/73 (68.49%), Postives = 60/73 (82.19%), Query Frame = 1
BLAST of CmoCh07G011180 vs. Swiss-Prot
Match: LAC11_ARATH (Laccase-11 OS=Arabidopsis thaliana GN=LAC11 PE=2 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 1.8e-18 Identity = 42/80 (52.50%), Postives = 59/80 (73.75%), Query Frame = 1
BLAST of CmoCh07G011180 vs. Swiss-Prot
Match: LAC16_ARATH (Laccase-16 OS=Arabidopsis thaliana GN=LAC16 PE=2 SV=2) HSP 1 Score: 91.7 bits (226), Expect = 4.0e-18 Identity = 45/78 (57.69%), Postives = 57/78 (73.08%), Query Frame = 1
BLAST of CmoCh07G011180 vs. Swiss-Prot
Match: LAC22_ORYSJ (Laccase-22 OS=Oryza sativa subsp. japonica GN=LAC22 PE=2 SV=2) HSP 1 Score: 90.9 bits (224), Expect = 6.9e-18 Identity = 41/78 (52.56%), Postives = 58/78 (74.36%), Query Frame = 1
BLAST of CmoCh07G011180 vs. TrEMBL
Match: A0A0A0L192_CUCSA (Laccase OS=Cucumis sativus GN=Csa_4G308480 PE=3 SV=1) HSP 1 Score: 146.4 bits (368), Expect = 1.5e-32 Identity = 70/80 (87.50%), Postives = 74/80 (92.50%), Query Frame = 1
BLAST of CmoCh07G011180 vs. TrEMBL
Match: W9S024_9ROSA (Laccase OS=Morus notabilis GN=L484_022065 PE=3 SV=1) HSP 1 Score: 136.3 bits (342), Expect = 1.6e-29 Identity = 62/76 (81.58%), Postives = 72/76 (94.74%), Query Frame = 1
BLAST of CmoCh07G011180 vs. TrEMBL
Match: W9RP91_9ROSA (Laccase OS=Morus notabilis GN=L484_022066 PE=3 SV=1) HSP 1 Score: 133.3 bits (334), Expect = 1.3e-28 Identity = 61/76 (80.26%), Postives = 70/76 (92.11%), Query Frame = 1
BLAST of CmoCh07G011180 vs. TrEMBL
Match: A0A0H4CW03_BETPL (Laccase OS=Betula platyphylla GN=LAC1 PE=2 SV=1) HSP 1 Score: 131.3 bits (329), Expect = 5.1e-28 Identity = 61/79 (77.22%), Postives = 72/79 (91.14%), Query Frame = 1
BLAST of CmoCh07G011180 vs. TrEMBL
Match: A0A0D2TTA8_GOSRA (Laccase OS=Gossypium raimondii GN=B456_007G378200 PE=3 SV=1) HSP 1 Score: 130.6 bits (327), Expect = 8.7e-28 Identity = 59/80 (73.75%), Postives = 72/80 (90.00%), Query Frame = 1
BLAST of CmoCh07G011180 vs. TAIR10
Match: AT5G01190.1 (AT5G01190.1 laccase 10) HSP 1 Score: 107.8 bits (268), Expect = 3.1e-24 Identity = 50/77 (64.94%), Postives = 65/77 (84.42%), Query Frame = 1
BLAST of CmoCh07G011180 vs. TAIR10
Match: AT2G38080.1 (AT2G38080.1 Laccase/Diphenol oxidase family protein) HSP 1 Score: 106.7 bits (265), Expect = 6.8e-24 Identity = 50/73 (68.49%), Postives = 60/73 (82.19%), Query Frame = 1
BLAST of CmoCh07G011180 vs. TAIR10
Match: AT5G03260.1 (AT5G03260.1 laccase 11) HSP 1 Score: 92.8 bits (229), Expect = 1.0e-19 Identity = 42/80 (52.50%), Postives = 59/80 (73.75%), Query Frame = 1
BLAST of CmoCh07G011180 vs. TAIR10
Match: AT5G58910.1 (AT5G58910.1 laccase 16) HSP 1 Score: 90.1 bits (222), Expect = 6.6e-19 Identity = 40/49 (81.63%), Postives = 45/49 (91.84%), Query Frame = 1
BLAST of CmoCh07G011180 vs. TAIR10
Match: AT2G29130.1 (AT2G29130.1 laccase 2) HSP 1 Score: 84.7 bits (208), Expect = 2.8e-17 Identity = 37/57 (64.91%), Postives = 44/57 (77.19%), Query Frame = 1
BLAST of CmoCh07G011180 vs. NCBI nr
Match: gi|449460379|ref|XP_004147923.1| (PREDICTED: laccase-4-like [Cucumis sativus]) HSP 1 Score: 146.4 bits (368), Expect = 2.2e-32 Identity = 70/80 (87.50%), Postives = 74/80 (92.50%), Query Frame = 1
BLAST of CmoCh07G011180 vs. NCBI nr
Match: gi|659069311|ref|XP_008449180.1| (PREDICTED: laccase-4-like [Cucumis melo]) HSP 1 Score: 146.4 bits (368), Expect = 2.2e-32 Identity = 70/80 (87.50%), Postives = 74/80 (92.50%), Query Frame = 1
BLAST of CmoCh07G011180 vs. NCBI nr
Match: gi|703130672|ref|XP_010104682.1| (hypothetical protein L484_022065 [Morus notabilis]) HSP 1 Score: 136.3 bits (342), Expect = 2.3e-29 Identity = 62/76 (81.58%), Postives = 72/76 (94.74%), Query Frame = 1
BLAST of CmoCh07G011180 vs. NCBI nr
Match: gi|698478487|ref|XP_009786393.1| (PREDICTED: laccase-4-like [Nicotiana sylvestris]) HSP 1 Score: 133.3 bits (334), Expect = 1.9e-28 Identity = 56/76 (73.68%), Postives = 72/76 (94.74%), Query Frame = 1
BLAST of CmoCh07G011180 vs. NCBI nr
Match: gi|703130675|ref|XP_010104683.1| (hypothetical protein L484_022066 [Morus notabilis]) HSP 1 Score: 133.3 bits (334), Expect = 1.9e-28 Identity = 61/76 (80.26%), Postives = 70/76 (92.11%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |