CmoCh06G014320 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.GAAAGGGACCTCGACAAGCTCCTCCATAGGCCCGGTAACCTCATTGGCGCCAATTTTGAGCCCGGTTCTCGAGTGGGTCCTTCCTCTTCTTCTCTCCGACATTTTTTCACCTTGTGTTCAGTACATGGTCTGCAATCGTCTTGCGCCTTAAGTTGATTTGAGTTACAGTTGAGGGATGATCTTCAACAGTACGTTCAAGTGTTGGTCATTGGAGATGGAGCGTCGGAAGATTTGGCTGTGTCGGGTTTTCGGAATCTGGAAGTCATTGACATGGATCGCATCGAAGTTACAAATCTCAATCCTCAGTTTCTCTTCAGGTTCCAACGATTTTCACGGTTCTATGCGTAG GAAAGGGACCTCGACAAGCTCCTCCATAGGCCCGGTAACCTCATTGGCGCCAATTTTGAGCCCGGTTCTCGATTGAGGGATGATCTTCAACAGTACGTTCAAGTGTTGGTCATTGGAGATGGAGCGTCGGAAGATTTGGCTGTGTCGGGTTTTCGGAATCTGGAAGTCATTGACATGGATCGCATCGAAGTTACAAATCTCAATCCTCAGTTTCTCTTCAGGTTCCAACGATTTTCACGGTTCTATGCGTAG GAAAGGGACCTCGACAAGCTCCTCCATAGGCCCGGTAACCTCATTGGCGCCAATTTTGAGCCCGGTTCTCGATTGAGGGATGATCTTCAACAGTACGTTCAAGTGTTGGTCATTGGAGATGGAGCGTCGGAAGATTTGGCTGTGTCGGGTTTTCGGAATCTGGAAGTCATTGACATGGATCGCATCGAAGTTACAAATCTCAATCCTCAGTTTCTCTTCAGGTTCCAACGATTTTCACGGTTCTATGCGTAG
BLAST of CmoCh06G014320 vs. Swiss-Prot
Match: UBA3_ARATH (NEDD8-activating enzyme E1 catalytic subunit OS=Arabidopsis thaliana GN=ECR1 PE=1 SV=2) HSP 1 Score: 103.6 bits (257), Expect = 1.1e-21 Identity = 53/80 (66.25%), Postives = 61/80 (76.25%), Query Frame = 1
BLAST of CmoCh06G014320 vs. Swiss-Prot
Match: UBA3_DICDI (NEDD8-activating enzyme E1 catalytic subunit OS=Dictyostelium discoideum GN=uba3 PE=1 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.7e-11 Identity = 36/81 (44.44%), Postives = 54/81 (66.67%), Query Frame = 1
BLAST of CmoCh06G014320 vs. Swiss-Prot
Match: UBA3_HUMAN (NEDD8-activating enzyme E1 catalytic subunit OS=Homo sapiens GN=UBA3 PE=1 SV=2) HSP 1 Score: 62.4 bits (150), Expect = 2.7e-09 Identity = 35/74 (47.30%), Postives = 44/74 (59.46%), Query Frame = 1
BLAST of CmoCh06G014320 vs. Swiss-Prot
Match: UBA3_MOUSE (NEDD8-activating enzyme E1 catalytic subunit OS=Mus musculus GN=Uba3 PE=1 SV=2) HSP 1 Score: 62.4 bits (150), Expect = 2.7e-09 Identity = 35/74 (47.30%), Postives = 44/74 (59.46%), Query Frame = 1
BLAST of CmoCh06G014320 vs. Swiss-Prot
Match: UBA3_PONAB (NEDD8-activating enzyme E1 catalytic subunit OS=Pongo abelii GN=UBA3 PE=2 SV=2) HSP 1 Score: 62.4 bits (150), Expect = 2.7e-09 Identity = 35/74 (47.30%), Postives = 44/74 (59.46%), Query Frame = 1
BLAST of CmoCh06G014320 vs. TrEMBL
Match: A0A0A0L8U2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G149920 PE=4 SV=1) HSP 1 Score: 124.8 bits (312), Expect = 5.0e-26 Identity = 64/80 (80.00%), Postives = 69/80 (86.25%), Query Frame = 1
BLAST of CmoCh06G014320 vs. TrEMBL
Match: W1PXY3_AMBTC (Uncharacterized protein OS=Amborella trichopoda GN=AMTR_s00025p00060820 PE=4 SV=1) HSP 1 Score: 115.2 bits (287), Expect = 3.9e-23 Identity = 57/80 (71.25%), Postives = 65/80 (81.25%), Query Frame = 1
BLAST of CmoCh06G014320 vs. TrEMBL
Match: A0A061EL40_THECC (E1 C-terminal related 1 isoform 1 OS=Theobroma cacao GN=TCM_020541 PE=4 SV=1) HSP 1 Score: 114.0 bits (284), Expect = 8.7e-23 Identity = 56/80 (70.00%), Postives = 66/80 (82.50%), Query Frame = 1
BLAST of CmoCh06G014320 vs. TrEMBL
Match: A0A061EMG3_THECC (E1 C-terminal related 1 isoform 2 (Fragment) OS=Theobroma cacao GN=TCM_020541 PE=4 SV=1) HSP 1 Score: 114.0 bits (284), Expect = 8.7e-23 Identity = 56/80 (70.00%), Postives = 66/80 (82.50%), Query Frame = 1
BLAST of CmoCh06G014320 vs. TrEMBL
Match: I1MR79_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_17G016000 PE=4 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 1.9e-22 Identity = 56/80 (70.00%), Postives = 64/80 (80.00%), Query Frame = 1
BLAST of CmoCh06G014320 vs. TAIR10
Match: AT5G19180.1 (AT5G19180.1 E1 C-terminal related 1) HSP 1 Score: 103.6 bits (257), Expect = 6.0e-23 Identity = 53/80 (66.25%), Postives = 61/80 (76.25%), Query Frame = 1
BLAST of CmoCh06G014320 vs. TAIR10
Match: AT2G21470.2 (AT2G21470.2 SUMO-activating enzyme 2) HSP 1 Score: 47.4 bits (111), Expect = 5.1e-06 Identity = 24/46 (52.17%), Postives = 33/46 (71.74%), Query Frame = 1
BLAST of CmoCh06G014320 vs. NCBI nr
Match: gi|449432724|ref|XP_004134149.1| (PREDICTED: NEDD8-activating enzyme E1 catalytic subunit [Cucumis sativus]) HSP 1 Score: 124.8 bits (312), Expect = 7.1e-26 Identity = 64/80 (80.00%), Postives = 69/80 (86.25%), Query Frame = 1
BLAST of CmoCh06G014320 vs. NCBI nr
Match: gi|659076491|ref|XP_008438709.1| (PREDICTED: NEDD8-activating enzyme E1 catalytic subunit [Cucumis melo]) HSP 1 Score: 124.8 bits (312), Expect = 7.1e-26 Identity = 64/80 (80.00%), Postives = 69/80 (86.25%), Query Frame = 1
BLAST of CmoCh06G014320 vs. NCBI nr
Match: gi|586747014|ref|XP_006850744.1| (PREDICTED: NEDD8-activating enzyme E1 catalytic subunit [Amborella trichopoda]) HSP 1 Score: 115.2 bits (287), Expect = 5.6e-23 Identity = 57/80 (71.25%), Postives = 65/80 (81.25%), Query Frame = 1
BLAST of CmoCh06G014320 vs. NCBI nr
Match: gi|470121753|ref|XP_004296925.1| (PREDICTED: NEDD8-activating enzyme E1 catalytic subunit [Fragaria vesca subsp. vesca]) HSP 1 Score: 115.2 bits (287), Expect = 5.6e-23 Identity = 58/80 (72.50%), Postives = 66/80 (82.50%), Query Frame = 1
BLAST of CmoCh06G014320 vs. NCBI nr
Match: gi|720000089|ref|XP_010255917.1| (PREDICTED: NEDD8-activating enzyme E1 catalytic subunit [Nelumbo nucifera]) HSP 1 Score: 114.4 bits (285), Expect = 9.6e-23 Identity = 56/80 (70.00%), Postives = 65/80 (81.25%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |