CmoCh05G010860 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTCGAGACTTCTTGGCCGTGCAGGCAACGTCGGTGGCTCCTGAAGATCTGTTCTGCGGGAGAGGCGACGACATCGAGAAACAAAGATATTGTATGCCTCATGATGCCACACCAGCTCTCCTTTGTATCAAATCATGGATTCAAAGTGGTTTCAAGATGAATTACAAGTCTAATGAGATTGAGTATGAGATGCTGATTGAACTAGCTGCTACATCAATTGTCGATAGCAATTCTGCTGGTTCTGACAAGAAATCAAAGTAA ATGGCTCGAGACTTCTTGGCCGTGCAGGCAACGTCGGTGGCTCCTGAAGATCTGTTCTGCGGGAGAGGCGACGACATCGAGAAACAAAGATATTGTATGCCTCATGATGCCACACCAGCTCTCCTTTGTATCAAATCATGGATTCAAAGTGGTTTCAAGATGAATTACAAGTCTAATGAGATTGAGTATGAGATGCTGATTGAACTAGCTGCTACATCAATTGTCGATAGCAATTCTGCTGGTTCTGACAAGAAATCAAAGTAA ATGGCTCGAGACTTCTTGGCCGTGCAGGCAACGTCGGTGGCTCCTGAAGATCTGTTCTGCGGGAGAGGCGACGACATCGAGAAACAAAGATATTGTATGCCTCATGATGCCACACCAGCTCTCCTTTGTATCAAATCATGGATTCAAAGTGGTTTCAAGATGAATTACAAGTCTAATGAGATTGAGTATGAGATGCTGATTGAACTAGCTGCTACATCAATTGTCGATAGCAATTCTGCTGGTTCTGACAAGAAATCAAAGTAA
BLAST of CmoCh05G010860 vs. TrEMBL
Match: A0A0A0LGZ3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G034510 PE=4 SV=1) HSP 1 Score: 159.8 bits (403), Expect = 1.5e-36 Identity = 73/87 (83.91%), Postives = 84/87 (96.55%), Query Frame = 1
BLAST of CmoCh05G010860 vs. TrEMBL
Match: A0A061G1J7_THECC (BED zinc finger,hAT family dimerization domain OS=Theobroma cacao GN=TCM_012243 PE=4 SV=1) HSP 1 Score: 134.0 bits (336), Expect = 8.6e-29 Identity = 60/87 (68.97%), Postives = 73/87 (83.91%), Query Frame = 1
BLAST of CmoCh05G010860 vs. TrEMBL
Match: A0A0D2SC04_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_007G008000 PE=4 SV=1) HSP 1 Score: 132.1 bits (331), Expect = 3.3e-28 Identity = 58/87 (66.67%), Postives = 72/87 (82.76%), Query Frame = 1
BLAST of CmoCh05G010860 vs. TrEMBL
Match: A0A0D2P0V7_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_007G008000 PE=4 SV=1) HSP 1 Score: 132.1 bits (331), Expect = 3.3e-28 Identity = 58/87 (66.67%), Postives = 72/87 (82.76%), Query Frame = 1
BLAST of CmoCh05G010860 vs. TrEMBL
Match: A0A0B0PVA3_GOSAR (Putative AC transposase OS=Gossypium arboreum GN=F383_15265 PE=4 SV=1) HSP 1 Score: 130.2 bits (326), Expect = 1.2e-27 Identity = 57/87 (65.52%), Postives = 71/87 (81.61%), Query Frame = 1
BLAST of CmoCh05G010860 vs. TAIR10
Match: AT1G18560.1 (AT1G18560.1 BED zinc finger ;hAT family dimerisation domain) HSP 1 Score: 125.2 bits (313), Expect = 2.0e-29 Identity = 51/84 (60.71%), Postives = 73/84 (86.90%), Query Frame = 1
BLAST of CmoCh05G010860 vs. NCBI nr
Match: gi|778667069|ref|XP_011648867.1| (PREDICTED: zinc finger BED domain-containing protein DAYSLEEPER isoform X3 [Cucumis sativus]) HSP 1 Score: 159.8 bits (403), Expect = 2.1e-36 Identity = 73/87 (83.91%), Postives = 84/87 (96.55%), Query Frame = 1
BLAST of CmoCh05G010860 vs. NCBI nr
Match: gi|778667051|ref|XP_011648862.1| (PREDICTED: zinc finger BED domain-containing protein DAYSLEEPER isoform X1 [Cucumis sativus]) HSP 1 Score: 159.8 bits (403), Expect = 2.1e-36 Identity = 73/87 (83.91%), Postives = 84/87 (96.55%), Query Frame = 1
BLAST of CmoCh05G010860 vs. NCBI nr
Match: gi|659070124|ref|XP_008453529.1| (PREDICTED: putative AC transposase isoform X2 [Cucumis melo]) HSP 1 Score: 159.8 bits (403), Expect = 2.1e-36 Identity = 73/87 (83.91%), Postives = 84/87 (96.55%), Query Frame = 1
BLAST of CmoCh05G010860 vs. NCBI nr
Match: gi|778667061|ref|XP_011648865.1| (PREDICTED: zinc finger BED domain-containing protein DAYSLEEPER isoform X2 [Cucumis sativus]) HSP 1 Score: 159.8 bits (403), Expect = 2.1e-36 Identity = 73/87 (83.91%), Postives = 84/87 (96.55%), Query Frame = 1
BLAST of CmoCh05G010860 vs. NCBI nr
Match: gi|659070128|ref|XP_008453542.1| (PREDICTED: putative AC transposase isoform X3 [Cucumis melo]) HSP 1 Score: 159.8 bits (403), Expect = 2.1e-36 Identity = 73/87 (83.91%), Postives = 84/87 (96.55%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|