CmoCh04G020730 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAATCCACTGATTTCTGCCGCTTCCGTTATTGCTGCTGGATTGGCCGTCGGGCTTGCTTCTATTGGACCTGGGGTTGGTCAAGGTACTGCTGCGGGCCAAGCTGTAGAAGGGATCGCGAGACAACCCGAGGCGGAGGGAAAAATCCGAGGTACTTTATTGCTTAGTCTGGCTTTTATGGAAGCTTTAACAATTTATGGACTGGTTGTAGCATTAGCACTTTTATTTGCGAATCCTTTTGTTTAA ATGAATCCACTGATTTCTGCCGCTTCCGTTATTGCTGCTGGATTGGCCGTCGGGCTTGCTTCTATTGGACCTGGGGTTGGTCAAGGTACTGCTGCGGGCCAAGCTGTAGAAGGGATCGCGAGACAACCCGAGGCGGAGGGAAAAATCCGAGGTACTTTATTGCTTAGTCTGGCTTTTATGGAAGCTTTAACAATTTATGGACTGGTTGTAGCATTAGCACTTTTATTTGCGAATCCTTTTGTTTAA ATGAATCCACTGATTTCTGCCGCTTCCGTTATTGCTGCTGGATTGGCCGTCGGGCTTGCTTCTATTGGACCTGGGGTTGGTCAAGGTACTGCTGCGGGCCAAGCTGTAGAAGGGATCGCGAGACAACCCGAGGCGGAGGGAAAAATCCGAGGTACTTTATTGCTTAGTCTGGCTTTTATGGAAGCTTTAACAATTTATGGACTGGTTGTAGCATTAGCACTTTTATTTGCGAATCCTTTTGTTTAA
BLAST of CmoCh04G020730 vs. Swiss-Prot
Match: ATPH_ADICA (ATP synthase subunit c, chloroplastic OS=Adiantum capillus-veneris GN=atpH PE=2 SV=2) HSP 1 Score: 141.4 bits (355), Expect = 4.5e-33 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. Swiss-Prot
Match: ATPH_ILLOL (ATP synthase subunit c, chloroplastic OS=Illicium oligandrum GN=atpH PE=3 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 4.5e-33 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. Swiss-Prot
Match: ATPH_JASNU (ATP synthase subunit c, chloroplastic OS=Jasminum nudiflorum GN=atpH PE=3 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 4.5e-33 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. Swiss-Prot
Match: ATPH_LACSA (ATP synthase subunit c, chloroplastic OS=Lactuca sativa GN=atpH PE=3 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 4.5e-33 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. Swiss-Prot
Match: ATPH_LEMMI (ATP synthase subunit c, chloroplastic OS=Lemna minor GN=atpH PE=3 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 4.5e-33 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. TrEMBL
Match: A0A168RBZ2_SOLME (ATP synthase CF0 subunit III OS=Solanum melongena GN=atpH PE=4 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 5.0e-31 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. TrEMBL
Match: A0A0S2IFT3_9ROSI (AtpH OS=Cucurbita okeechobeensis GN=atpH PE=3 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 5.0e-31 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. TrEMBL
Match: E3T2M6_9TRAC (ATP synthase subunit c, chloroplastic OS=Isoetes flaccida GN=atpH PE=3 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 5.0e-31 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. TrEMBL
Match: D3WBV9_9MAGN (ATP synthase subunit c, chloroplastic OS=Meliosma aff. cuneifolia Moore 333 GN=atpH PE=3 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 5.0e-31 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. TrEMBL
Match: H2F562_9ASPA (ATP synthase subunit c, chloroplastic OS=Triteleia hyacinthina GN=atpH PE=3 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 5.0e-31 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. TAIR10
Match: ATCG00140.1 (ATCG00140.1 ATP synthase subunit C family protein) HSP 1 Score: 141.0 bits (354), Expect = 3.3e-34 Identity = 80/81 (98.77%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. NCBI nr
Match: gi|927371887|ref|YP_009164185.1| (ATP synthase CF0 subunit III (chloroplast) [Viscum minimum]) HSP 1 Score: 141.4 bits (355), Expect = 7.2e-31 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. NCBI nr
Match: gi|757609166|ref|WP_042854983.1| (ATP F0F1 synthase subunit C [Staphylococcus aureus]) HSP 1 Score: 141.4 bits (355), Expect = 7.2e-31 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. NCBI nr
Match: gi|953244968|ref|YP_009180095.1| (ATP synthase CF0 subunit III (chloroplast) [Polygonatum cyrtonema]) HSP 1 Score: 141.4 bits (355), Expect = 7.2e-31 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. NCBI nr
Match: gi|546352760|gb|AGW96663.1| (ATP synthase CF0 subunit III (chloroplast) [Argyreia nervosa]) HSP 1 Score: 141.4 bits (355), Expect = 7.2e-31 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020730 vs. NCBI nr
Match: gi|944542073|ref|YP_009175992.1| (ATP synthase CF0 subunit III (chloroplast) [Ficus racemosa]) HSP 1 Score: 141.4 bits (355), Expect = 7.2e-31 Identity = 81/81 (100.00%), Postives = 81/81 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|