CmoCh04G013960 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTACGTTGCTTCAATTTAGTGTCCATTTTCGTCCTCGCCGCCGTTGCGGTCTCGATGGTAGTTCTGCCCTTGGTTCTTCCGCCGCTGCCTCCCCCTCCGATTGTGCTTCTCTTCTTTCCGGTTGGACTCATGGCGGCGCTCCTCATCCTCGCCTTTTCTCCCTCCGATGTCGGCGTCGATAATTTCGATTTATGA ATGGTACGTTGCTTCAATTTAGTGTCCATTTTCGTCCTCGCCGCCGTTGCGGTCTCGATGGTAGTTCTGCCCTTGGTTCTTCCGCCGCTGCCTCCCCCTCCGATTGTGCTTCTCTTCTTTCCGGTTGGACTCATGGCGGCGCTCCTCATCCTCGCCTTTTCTCCCTCCGATGTCGGCGTCGATAATTTCGATTTATGA ATGGTACGTTGCTTCAATTTAGTGTCCATTTTCGTCCTCGCCGCCGTTGCGGTCTCGATGGTAGTTCTGCCCTTGGTTCTTCCGCCGCTGCCTCCCCCTCCGATTGTGCTTCTCTTCTTTCCGGTTGGACTCATGGCGGCGCTCCTCATCCTCGCCTTTTCTCCCTCCGATGTCGGCGTCGATAATTTCGATTTATGA
BLAST of CmoCh04G013960 vs. Swiss-Prot
Match: ARGOS_ARATH (Protein AUXIN-REGULATED GENE INVOLVED IN ORGAN SIZE OS=Arabidopsis thaliana GN=ARGOS PE=2 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 2.3e-08 Identity = 31/61 (50.82%), Postives = 44/61 (72.13%), Query Frame = 1
BLAST of CmoCh04G013960 vs. Swiss-Prot
Match: ARGOS_BRARP (Protein AUXIN-REGULATED GENE INVOLVED IN ORGAN SIZE OS=Brassica rapa subsp. pekinensis GN=ARGOS PE=2 SV=2) HSP 1 Score: 56.2 bits (134), Expect = 1.5e-07 Identity = 29/52 (55.77%), Postives = 40/52 (76.92%), Query Frame = 1
BLAST of CmoCh04G013960 vs. Swiss-Prot
Match: ARL_ARATH (ARGOS-like protein OS=Arabidopsis thaliana GN=ARL PE=2 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 2.0e-07 Identity = 28/52 (53.85%), Postives = 40/52 (76.92%), Query Frame = 1
BLAST of CmoCh04G013960 vs. TrEMBL
Match: A0A0S3SKI1_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.07G232000 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.4e-14 Identity = 45/57 (78.95%), Postives = 54/57 (94.74%), Query Frame = 1
BLAST of CmoCh04G013960 vs. TrEMBL
Match: V7BSD6_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_005G025500g PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.4e-14 Identity = 45/57 (78.95%), Postives = 54/57 (94.74%), Query Frame = 1
BLAST of CmoCh04G013960 vs. TrEMBL
Match: A0A0L9UI81_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan05g004200 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.4e-14 Identity = 45/57 (78.95%), Postives = 54/57 (94.74%), Query Frame = 1
BLAST of CmoCh04G013960 vs. TrEMBL
Match: K7K5P8_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_11G156100 PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 9.9e-14 Identity = 45/57 (78.95%), Postives = 52/57 (91.23%), Query Frame = 1
BLAST of CmoCh04G013960 vs. TrEMBL
Match: I1JW38_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_04G135200 PE=4 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 2.9e-13 Identity = 44/57 (77.19%), Postives = 51/57 (89.47%), Query Frame = 1
BLAST of CmoCh04G013960 vs. TAIR10
Match: AT3G59900.1 (AT3G59900.1 auxin-regulated gene involved in organ size) HSP 1 Score: 58.9 bits (141), Expect = 1.3e-09 Identity = 31/61 (50.82%), Postives = 44/61 (72.13%), Query Frame = 1
BLAST of CmoCh04G013960 vs. TAIR10
Match: AT2G44080.1 (AT2G44080.1 ARGOS-like) HSP 1 Score: 55.8 bits (133), Expect = 1.1e-08 Identity = 28/52 (53.85%), Postives = 40/52 (76.92%), Query Frame = 1
BLAST of CmoCh04G013960 vs. NCBI nr
Match: gi|920699213|gb|KOM42438.1| (hypothetical protein LR48_Vigan05g004200 [Vigna angularis]) HSP 1 Score: 85.1 bits (209), Expect = 4.9e-14 Identity = 45/57 (78.95%), Postives = 54/57 (94.74%), Query Frame = 1
BLAST of CmoCh04G013960 vs. NCBI nr
Match: gi|593696882|ref|XP_007148923.1| (hypothetical protein PHAVU_005G025500g [Phaseolus vulgaris]) HSP 1 Score: 85.1 bits (209), Expect = 4.9e-14 Identity = 45/57 (78.95%), Postives = 54/57 (94.74%), Query Frame = 1
BLAST of CmoCh04G013960 vs. NCBI nr
Match: gi|947081278|gb|KRH30067.1| (hypothetical protein GLYMA_11G156100 [Glycine max]) HSP 1 Score: 83.6 bits (205), Expect = 1.4e-13 Identity = 45/57 (78.95%), Postives = 52/57 (91.23%), Query Frame = 1
BLAST of CmoCh04G013960 vs. NCBI nr
Match: gi|947114524|gb|KRH62826.1| (hypothetical protein GLYMA_04G135200 [Glycine max]) HSP 1 Score: 82.0 bits (201), Expect = 4.1e-13 Identity = 44/57 (77.19%), Postives = 51/57 (89.47%), Query Frame = 1
BLAST of CmoCh04G013960 vs. NCBI nr
Match: gi|357456395|ref|XP_003598478.1| (transmembrane protein, putative [Medicago truncatula]) HSP 1 Score: 80.1 bits (196), Expect = 1.6e-12 Identity = 42/57 (73.68%), Postives = 52/57 (91.23%), Query Frame = 1
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|