CmoCh04G000940 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGAGAAAAAGGAAAGGGAAGAAAGCTGGTGAAGGACTGCCAAATTCTCATGTAACCTAACTTTATCTGCCATCATCAAACATGAAGCTTTTCAAAGGAATAATATTTCCAATTGCCCACTTCTTCATTTTTTTTTTTTTTTTTTTTTNNNNNNNNNNGGCATAGCCAAGGCTTGCAAGTTTCCTCAAGCATACGTGCCATTTGGGGCAGGGCCTCGACTATGTTTAGGGAAGAACTTTGCGTTGGTTCAGTTGAAGATCGTTATTTCTCTGATAGTTTCCAAGTTTAGATTTTCATTGTCTTCTGAATATCGCCATTCTCCGTCGTATAGAATGATCGTAGAGCCGGCCAATGGGATGAAGATCATCTTCAAAAGGGTTTAA ATGGGAGAAAAAGGAAAGGGAAGAAAGCTGGCTTGCAAGTTTCCTCAAGCATACGTGCCATTTGGGGCAGGGCCTCGACTATGTTTAGGGAAGAACTTTGCGTTGGTTCAGTTGAAGATCGTTATTTCTCTGATAGTTTCCAAGTTTAGATTTTCATTGTCTTCTGAATATCGCCATTCTCCGTCGTATAGAATGATCGTAGAGCCGGCCAATGGGATGAAGATCATCTTCAAAAGGGTTTAA ATGGGAGAAAAAGGAAAGGGAAGAAAGCTGGCTTGCAAGTTTCCTCAAGCATACGTGCCATTTGGGGCAGGGCCTCGACTATGTTTAGGGAAGAACTTTGCGTTGGTTCAGTTGAAGATCGTTATTTCTCTGATAGTTTCCAAGTTTAGATTTTCATTGTCTTCTGAATATCGCCATTCTCCGTCGTATAGAATGATCGTAGAGCCGGCCAATGGGATGAAGATCATCTTCAAAAGGGTTTAA
BLAST of CmoCh04G000940 vs. Swiss-Prot
Match: C14A2_ARATH (Cytochrome P450 714A2 OS=Arabidopsis thaliana GN=CYP714A2 PE=2 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 9.6e-20 Identity = 39/70 (55.71%), Postives = 59/70 (84.29%), Query Frame = 1
BLAST of CmoCh04G000940 vs. Swiss-Prot
Match: C14A1_ARATH (Cytochrome P450 714A1 OS=Arabidopsis thaliana GN=CYP714A1 PE=2 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 4.8e-19 Identity = 41/70 (58.57%), Postives = 57/70 (81.43%), Query Frame = 1
BLAST of CmoCh04G000940 vs. Swiss-Prot
Match: C14D1_ORYSJ (Cytochrome P450 714D1 OS=Oryza sativa subsp. japonica GN=CYP714D1 PE=1 SV=1) HSP 1 Score: 85.5 bits (210), Expect = 2.9e-16 Identity = 36/74 (48.65%), Postives = 58/74 (78.38%), Query Frame = 1
BLAST of CmoCh04G000940 vs. Swiss-Prot
Match: C14C2_ORYSJ (Cytochrome P450 714C2 OS=Oryza sativa subsp. japonica GN=CYP714C2 PE=2 SV=1) HSP 1 Score: 85.5 bits (210), Expect = 2.9e-16 Identity = 35/70 (50.00%), Postives = 51/70 (72.86%), Query Frame = 1
BLAST of CmoCh04G000940 vs. Swiss-Prot
Match: C14C3_ORYSJ (Cytochrome P450 714C3 OS=Oryza sativa subsp. japonica GN=CYP714C3 PE=3 SV=2) HSP 1 Score: 79.7 bits (195), Expect = 1.6e-14 Identity = 32/74 (43.24%), Postives = 52/74 (70.27%), Query Frame = 1
BLAST of CmoCh04G000940 vs. TrEMBL
Match: A0A0A0KQQ7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G224130 PE=3 SV=1) HSP 1 Score: 131.3 bits (329), Expect = 5.1e-28 Identity = 61/70 (87.14%), Postives = 67/70 (95.71%), Query Frame = 1
BLAST of CmoCh04G000940 vs. TrEMBL
Match: A0A068UZA3_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00038999001 PE=3 SV=1) HSP 1 Score: 115.2 bits (287), Expect = 3.8e-23 Identity = 51/69 (73.91%), Postives = 61/69 (88.41%), Query Frame = 1
BLAST of CmoCh04G000940 vs. TrEMBL
Match: A0A0V0IHE6_SOLCH (Putative ovule protein OS=Solanum chacoense PE=3 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.9e-23 Identity = 50/70 (71.43%), Postives = 62/70 (88.57%), Query Frame = 1
BLAST of CmoCh04G000940 vs. TrEMBL
Match: M1A2X2_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400005261 PE=3 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.9e-23 Identity = 50/70 (71.43%), Postives = 62/70 (88.57%), Query Frame = 1
BLAST of CmoCh04G000940 vs. TrEMBL
Match: M1A2W9_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400005261 PE=3 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.9e-23 Identity = 50/70 (71.43%), Postives = 62/70 (88.57%), Query Frame = 1
BLAST of CmoCh04G000940 vs. TAIR10
Match: AT5G24900.1 (AT5G24900.1 cytochrome P450, family 714, subfamily A, polypeptide 2) HSP 1 Score: 97.1 bits (240), Expect = 5.4e-21 Identity = 39/70 (55.71%), Postives = 59/70 (84.29%), Query Frame = 1
BLAST of CmoCh04G000940 vs. TAIR10
Match: AT5G24910.1 (AT5G24910.1 cytochrome P450, family 714, subfamily A, polypeptide 1) HSP 1 Score: 94.7 bits (234), Expect = 2.7e-20 Identity = 41/70 (58.57%), Postives = 57/70 (81.43%), Query Frame = 1
BLAST of CmoCh04G000940 vs. TAIR10
Match: AT5G52400.1 (AT5G52400.1 cytochrome P450, family 715, subfamily A, polypeptide 1) HSP 1 Score: 72.8 bits (177), Expect = 1.1e-13 Identity = 29/67 (43.28%), Postives = 46/67 (68.66%), Query Frame = 1
BLAST of CmoCh04G000940 vs. TAIR10
Match: AT5G38450.1 (AT5G38450.1 cytochrome P450, family 735, subfamily A, polypeptide 1) HSP 1 Score: 70.5 bits (171), Expect = 5.4e-13 Identity = 26/61 (42.62%), Postives = 46/61 (75.41%), Query Frame = 1
BLAST of CmoCh04G000940 vs. TAIR10
Match: AT1G67110.1 (AT1G67110.1 cytochrome P450, family 735, subfamily A, polypeptide 2) HSP 1 Score: 69.3 bits (168), Expect = 1.2e-12 Identity = 25/61 (40.98%), Postives = 47/61 (77.05%), Query Frame = 1
BLAST of CmoCh04G000940 vs. NCBI nr
Match: gi|449457460|ref|XP_004146466.1| (PREDICTED: cytochrome P450 714A1-like [Cucumis sativus]) HSP 1 Score: 131.3 bits (329), Expect = 7.3e-28 Identity = 61/70 (87.14%), Postives = 67/70 (95.71%), Query Frame = 1
BLAST of CmoCh04G000940 vs. NCBI nr
Match: gi|700195580|gb|KGN50757.1| (hypothetical protein Csa_5G224130 [Cucumis sativus]) HSP 1 Score: 131.3 bits (329), Expect = 7.3e-28 Identity = 61/70 (87.14%), Postives = 67/70 (95.71%), Query Frame = 1
BLAST of CmoCh04G000940 vs. NCBI nr
Match: gi|659130610|ref|XP_008465257.1| (PREDICTED: cytochrome P450 714A1-like [Cucumis melo]) HSP 1 Score: 131.0 bits (328), Expect = 9.6e-28 Identity = 60/70 (85.71%), Postives = 67/70 (95.71%), Query Frame = 1
BLAST of CmoCh04G000940 vs. NCBI nr
Match: gi|697183315|ref|XP_009600679.1| (PREDICTED: cytochrome P450 714A1-like [Nicotiana tomentosiformis]) HSP 1 Score: 116.3 bits (290), Expect = 2.4e-23 Identity = 52/70 (74.29%), Postives = 62/70 (88.57%), Query Frame = 1
BLAST of CmoCh04G000940 vs. NCBI nr
Match: gi|698490445|ref|XP_009791714.1| (PREDICTED: cytochrome P450 714A1-like [Nicotiana sylvestris]) HSP 1 Score: 116.3 bits (290), Expect = 2.4e-23 Identity = 51/70 (72.86%), Postives = 63/70 (90.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |