CmoCh03G005980 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexonthree_prime_UTR Hold the cursor over a type above to highlight its positions in the sequence below.ATGCTGGGAACTTTCAGTCCTCAGGAAGAACCTTACACACACGAAATCCCAGAAGATACAACCCCATCTGGCATTTTTGCTCGAGGATCATATTCGGCCAAAACCAAGGTAATTCAACTTGGTGTTTTAGTCTCAAGAAATGGCCGTTTTAGTCCTTAAATGGATGAGAAGTTTGTTTGTTTGTTTGTGTGGGCTTGCTTGCAGTTTGTTGATGATGACAACAAGTGCTACCTGGAAATCAAGTACACATTTGATATCAAGAAAGATTGGCAATCATCTTAAAAGCAACAGGATTGATTCTCTCTCTTAATGATTGGTTTTGCAGCATTTGATCAATGTCTCTTTTGAACCGCATAAATTTGGTTTCAGTGTCCAAATATTTCATGTACTCTGTTTCTTTTGTCTCTTCATTCTTTCATGTACGTGCAATGAGACTGATGGCCTCAACCCTTTTCTCTTCTCTTTTTCTCAAAGGCAATTAAGAACGGA ATGCTGGGAACTTTCAGTCCTCAGGAAGAACCTTACACACACGAAATCCCAGAAGATACAACCCCATCTGGCATTTTTGCTCGAGGATCATATTCGGCCAAAACCAAGTTTGTTGATGATGACAACAAGTGCTACCTGGAAATCAAGTACACATTTGATATCAAGAAAGATTGGCAATCATCTTAAAAGCAACAGGATTGATTCTCTCTCTTAATGATTGGTTTTGCAGCATTTGATCAATGTCTCTTTTGAACCGCATAAATTTGGTTTCAGTGTCCAAATATTTCATGTACTCTGTTTCTTTTGTCTCTTCATTCTTTCATGTACGTGCAATGAGACTGATGGCCTCAACCCTTTTCTCTTCTCTTTTTCTCAAAGGCAATTAAGAACGGA ATGCTGGGAACTTTCAGTCCTCAGGAAGAACCTTACACACACGAAATCCCAGAAGATACAACCCCATCTGGCATTTTTGCTCGAGGATCATATTCGGCCAAAACCAAGTTTGTTGATGATGACAACAAGTGCTACCTGGAAATCAAGTACACATTTGATATCAAGAAAGATTGGCAATCATCTTAA
BLAST of CmoCh03G005980 vs. Swiss-Prot
Match: GDIR_ARATH (Rho GDP-dissociation inhibitor 1 OS=Arabidopsis thaliana GN=GDI1 PE=1 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 4.1e-23 Identity = 46/58 (79.31%), Postives = 54/58 (93.10%), Query Frame = 1
BLAST of CmoCh03G005980 vs. Swiss-Prot
Match: GDIR1_DICDI (Putative rho GDP-dissociation inhibitor 1 OS=Dictyostelium discoideum GN=rdiA PE=1 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 6.8e-10 Identity = 30/63 (47.62%), Postives = 42/63 (66.67%), Query Frame = 1
BLAST of CmoCh03G005980 vs. Swiss-Prot
Match: GDIR_SCHPO (Rho GDP-dissociation inhibitor OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=SPAC6F12.06 PE=1 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 1.3e-08 Identity = 25/59 (42.37%), Postives = 34/59 (57.63%), Query Frame = 1
BLAST of CmoCh03G005980 vs. Swiss-Prot
Match: GDIR1_HUMAN (Rho GDP-dissociation inhibitor 1 OS=Homo sapiens GN=ARHGDIA PE=1 SV=3) HSP 1 Score: 59.3 bits (142), Expect = 1.7e-08 Identity = 25/59 (42.37%), Postives = 37/59 (62.71%), Query Frame = 1
BLAST of CmoCh03G005980 vs. Swiss-Prot
Match: GDIR1_MACFA (Rho GDP-dissociation inhibitor 1 OS=Macaca fascicularis GN=ARHGDIA PE=2 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 1.7e-08 Identity = 25/59 (42.37%), Postives = 37/59 (62.71%), Query Frame = 1
BLAST of CmoCh03G005980 vs. TrEMBL
Match: M5WUV0_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa010564mg PE=4 SV=1) HSP 1 Score: 120.6 bits (301), Expect = 6.9e-25 Identity = 53/60 (88.33%), Postives = 57/60 (95.00%), Query Frame = 1
BLAST of CmoCh03G005980 vs. TrEMBL
Match: A0A059CF26_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_D01410 PE=4 SV=1) HSP 1 Score: 119.8 bits (299), Expect = 1.2e-24 Identity = 51/61 (83.61%), Postives = 59/61 (96.72%), Query Frame = 1
BLAST of CmoCh03G005980 vs. TrEMBL
Match: B9S3J1_RICCO (Rho GDP-dissociation inhibitor, putative OS=Ricinus communis GN=RCOM_0669590 PE=4 SV=1) HSP 1 Score: 119.8 bits (299), Expect = 1.2e-24 Identity = 52/61 (85.25%), Postives = 59/61 (96.72%), Query Frame = 1
BLAST of CmoCh03G005980 vs. TrEMBL
Match: A5BFT0_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_019936 PE=4 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 4.4e-24 Identity = 51/60 (85.00%), Postives = 58/60 (96.67%), Query Frame = 1
BLAST of CmoCh03G005980 vs. TrEMBL
Match: W9QMA2_9ROSA (Rho GDP-dissociation inhibitor 1 OS=Morus notabilis GN=L484_013647 PE=4 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 4.4e-24 Identity = 51/60 (85.00%), Postives = 57/60 (95.00%), Query Frame = 1
BLAST of CmoCh03G005980 vs. TAIR10
Match: AT3G07880.1 (AT3G07880.1 Immunoglobulin E-set superfamily protein) HSP 1 Score: 107.8 bits (268), Expect = 2.3e-24 Identity = 46/58 (79.31%), Postives = 54/58 (93.10%), Query Frame = 1
BLAST of CmoCh03G005980 vs. TAIR10
Match: AT1G62450.1 (AT1G62450.1 Immunoglobulin E-set superfamily protein) HSP 1 Score: 106.3 bits (264), Expect = 6.8e-24 Identity = 46/59 (77.97%), Postives = 52/59 (88.14%), Query Frame = 1
BLAST of CmoCh03G005980 vs. TAIR10
Match: AT1G12070.1 (AT1G12070.1 Immunoglobulin E-set superfamily protein) HSP 1 Score: 97.1 bits (240), Expect = 4.1e-21 Identity = 42/58 (72.41%), Postives = 49/58 (84.48%), Query Frame = 1
BLAST of CmoCh03G005980 vs. NCBI nr
Match: gi|778720199|ref|XP_011658125.1| (PREDICTED: rho GDP-dissociation inhibitor 1-like isoform X2 [Cucumis sativus]) HSP 1 Score: 124.4 bits (311), Expect = 6.8e-26 Identity = 55/61 (90.16%), Postives = 59/61 (96.72%), Query Frame = 1
BLAST of CmoCh03G005980 vs. NCBI nr
Match: gi|778720191|ref|XP_011658122.1| (PREDICTED: rho GDP-dissociation inhibitor 1-like isoform X1 [Cucumis sativus]) HSP 1 Score: 124.4 bits (311), Expect = 6.8e-26 Identity = 55/61 (90.16%), Postives = 59/61 (96.72%), Query Frame = 1
BLAST of CmoCh03G005980 vs. NCBI nr
Match: gi|659079087|ref|XP_008440067.1| (PREDICTED: rho GDP-dissociation inhibitor 1-like isoform X2 [Cucumis melo]) HSP 1 Score: 121.7 bits (304), Expect = 4.4e-25 Identity = 54/61 (88.52%), Postives = 59/61 (96.72%), Query Frame = 1
BLAST of CmoCh03G005980 vs. NCBI nr
Match: gi|659079083|ref|XP_008440065.1| (PREDICTED: rho GDP-dissociation inhibitor 1-like isoform X1 [Cucumis melo]) HSP 1 Score: 121.7 bits (304), Expect = 4.4e-25 Identity = 54/61 (88.52%), Postives = 59/61 (96.72%), Query Frame = 1
BLAST of CmoCh03G005980 vs. NCBI nr
Match: gi|694309068|ref|XP_009353488.1| (PREDICTED: rho GDP-dissociation inhibitor 1 [Pyrus x bretschneideri]) HSP 1 Score: 120.9 bits (302), Expect = 7.5e-25 Identity = 53/61 (86.89%), Postives = 58/61 (95.08%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|