CmoCh03G002330 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGATCCCTATGGTAACTGGGTTCATGAATTATGGTCAACAAACAGTACGAGCTATAAGGTACATTGGTCAGGGTTTCATGATTACTTTATCCCATGCAAATCGTTTGCCTGTAACTATTCAATATCCTTACGAAAAATTAATCGCATCGGAGCGTTTCCACGGTTGAGTCCATTTTGAATTTGATAAATGCATTGCTTGTGAAGTATGTGTTCGTGTATGTCCTATAGATCTCCCCGTTGTTGATTGAAAATTGGAAACGGATATTCGAAAGAAACGATTGCTTAATTACAGTATTGATTTCGAGATCTGTATATTTTGTAGTAACTGCATTGAATATTGTCAAACAAATTATTTATCAATGA ATGATCCCTATGGTAACTGGGTTCATGAATTATGGTCAACAAACAGTACGAGCTATAAGGTACATTGGTCAGGGTTTCATGATTACTTTATCCCATGCAAATCGTTTGCCTATCTCCCCGTTGTTGATTGAAAATTGGAAACGGATATTCGAAAGAAACGATTGCTTAATTACAGTATTGATTTCGAGATCTGTATATTTTGTAGTAACTGCATTGAATATTGTCAAACAAATTATTTATCAATGA ATGATCCCTATGGTAACTGGGTTCATGAATTATGGTCAACAAACAGTACGAGCTATAAGGTACATTGGTCAGGGTTTCATGATTACTTTATCCCATGCAAATCGTTTGCCTATCTCCCCGTTGTTGATTGAAAATTGGAAACGGATATTCGAAAGAAACGATTGCTTAATTACAGTATTGATTTCGAGATCTGTATATTTTGTAGTAACTGCATTGAATATTGTCAAACAAATTATTTATCAATGA
BLAST of CmoCh03G002330 vs. Swiss-Prot
Match: NDHI_EUCGG (NAD(P)H-quinone oxidoreductase subunit I, chloroplastic OS=Eucalyptus globulus subsp. globulus GN=ndhI PE=3 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 7.9e-14 Identity = 35/39 (89.74%), Postives = 37/39 (94.87%), Query Frame = 1
BLAST of CmoCh03G002330 vs. Swiss-Prot
Match: NDHI_OENEH (NAD(P)H-quinone oxidoreductase subunit I, chloroplastic OS=Oenothera elata subsp. hookeri GN=ndhI PE=3 SV=2) HSP 1 Score: 77.4 bits (189), Expect = 7.9e-14 Identity = 35/39 (89.74%), Postives = 37/39 (94.87%), Query Frame = 1
BLAST of CmoCh03G002330 vs. Swiss-Prot
Match: NDHI_PLAOC (NAD(P)H-quinone oxidoreductase subunit I, chloroplastic OS=Platanus occidentalis GN=ndhI PE=3 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 2.3e-13 Identity = 34/39 (87.18%), Postives = 37/39 (94.87%), Query Frame = 1
BLAST of CmoCh03G002330 vs. Swiss-Prot
Match: NDHI_CUCSA (NAD(P)H-quinone oxidoreductase subunit I, chloroplastic OS=Cucumis sativus GN=ndhI PE=3 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 2.3e-13 Identity = 34/39 (87.18%), Postives = 37/39 (94.87%), Query Frame = 1
BLAST of CmoCh03G002330 vs. Swiss-Prot
Match: NDHI_GOSHI (NAD(P)H-quinone oxidoreductase subunit I, chloroplastic OS=Gossypium hirsutum GN=ndhI PE=3 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 3.0e-13 Identity = 34/39 (87.18%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of CmoCh03G002330 vs. TrEMBL
Match: A0A0D2MAX1_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_002G166200 PE=4 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 8.0e-13 Identity = 51/120 (42.50%), Postives = 62/120 (51.67%), Query Frame = 1
BLAST of CmoCh03G002330 vs. TrEMBL
Match: A0A0K1NPW7_9MYRT (NADH-quinone oxidoreductase subunit I OS=Eugenia uniflora GN=ndhI PE=3 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 3.0e-12 Identity = 35/39 (89.74%), Postives = 38/39 (97.44%), Query Frame = 1
BLAST of CmoCh03G002330 vs. TrEMBL
Match: T1QPC4_EUCER (NAD(P)H-quinone oxidoreductase subunit I, chloroplastic OS=Eucalyptus erythrocorys GN=ndhI PE=3 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 6.8e-12 Identity = 36/39 (92.31%), Postives = 37/39 (94.87%), Query Frame = 1
BLAST of CmoCh03G002330 vs. TrEMBL
Match: T1QHV7_EUCVE (NAD(P)H-quinone oxidoreductase subunit I, chloroplastic OS=Eucalyptus verrucata GN=ndhI PE=3 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 8.8e-12 Identity = 35/39 (89.74%), Postives = 37/39 (94.87%), Query Frame = 1
BLAST of CmoCh03G002330 vs. TrEMBL
Match: A0A0N6WC04_CORYI (NAD(P)H-quinone oxidoreductase subunit I, chloroplastic OS=Corymbia citriodora subsp. citriodora GN=ndhI PE=3 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 8.8e-12 Identity = 35/39 (89.74%), Postives = 37/39 (94.87%), Query Frame = 1
BLAST of CmoCh03G002330 vs. TAIR10
Match: ATCG01090.1 (ATCG01090.1 NADPH dehydrogenases) HSP 1 Score: 75.1 bits (183), Expect = 2.2e-14 Identity = 32/39 (82.05%), Postives = 37/39 (94.87%), Query Frame = 1
BLAST of CmoCh03G002330 vs. NCBI nr
Match: gi|763747323|gb|KJB14762.1| (hypothetical protein B456_002G166200 [Gossypium raimondii]) HSP 1 Score: 80.9 bits (198), Expect = 1.1e-12 Identity = 51/120 (42.50%), Postives = 62/120 (51.67%), Query Frame = 1
BLAST of CmoCh03G002330 vs. NCBI nr
Match: gi|918021140|ref|YP_009163533.1| (NADH-plastoquinone oxidoreductase subunit I (plastid) [Eugenia uniflora]) HSP 1 Score: 79.0 bits (193), Expect = 4.4e-12 Identity = 35/39 (89.74%), Postives = 38/39 (97.44%), Query Frame = 1
BLAST of CmoCh03G002330 vs. NCBI nr
Match: gi|545718707|ref|YP_008577547.1| (NADH dehydrogenase subunit I (chloroplast) [Eucalyptus erythrocorys]) HSP 1 Score: 77.8 bits (190), Expect = 9.7e-12 Identity = 36/39 (92.31%), Postives = 37/39 (94.87%), Query Frame = 1
BLAST of CmoCh03G002330 vs. NCBI nr
Match: gi|984911416|gb|AMC31145.1| (NADH dehydrogenase subunit I (chloroplast) [Oenothera suffrutescens]) HSP 1 Score: 77.4 bits (189), Expect = 1.3e-11 Identity = 35/39 (89.74%), Postives = 37/39 (94.87%), Query Frame = 1
BLAST of CmoCh03G002330 vs. NCBI nr
Match: gi|782493188|gb|AJZ71647.1| (NADH-plastoquinone oxidoreductase subunit I (chloroplast) [Corymbia citriodora subsp. variegata]) HSP 1 Score: 77.4 bits (189), Expect = 1.3e-11 Identity = 35/39 (89.74%), Postives = 37/39 (94.87%), Query Frame = 1
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|