CmoCh02G006330 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGATGAGAATTCCTCAATCTTCAATAGCACAGAGGATAAAATCGTCTGCTATGCGCCAAGAATGATCACAACAAATGGGGTGTGGCAAGGCGACAACCCTTTGGAGTATTCTCTCCCTCTCTTCATCCTGCAGTTAACAATGGTGGTTATGATGACTCGCGCTTTGGTTTTCCTCTTAAAACCCTTTCGTCAACCTCGAGTCATCTCTGAAATTTTGGTGAGTTCAAGATTTTGTTTTCTTTTTCTGGGTTTTTTCTTGCAGCTAAATTGTTGGCATTTGAAGCTTTACACTTGA ATGGATGAGAATTCCTCAATCTTCAATAGCACAGAGGATAAAATCGTCTGCTATGCGCCAAGAATGATCACAACAAATGGGGTGTGGCAAGGCGACAACCCTTTGGAGTATTCTCTCCCTCTCTTCATCCTGCAGTTAACAATGGTGGTTATGATGACTCGCGCTTTGGTTTTCCTCTTAAAACCCTTTCGTCAACCTCGAGTCATCTCTGAAATTTTGCTAAATTGTTGGCATTTGAAGCTTTACACTTGA ATGGATGAGAATTCCTCAATCTTCAATAGCACAGAGGATAAAATCGTCTGCTATGCGCCAAGAATGATCACAACAAATGGGGTGTGGCAAGGCGACAACCCTTTGGAGTATTCTCTCCCTCTCTTCATCCTGCAGTTAACAATGGTGGTTATGATGACTCGCGCTTTGGTTTTCCTCTTAAAACCCTTTCGTCAACCTCGAGTCATCTCTGAAATTTTGCTAAATTGTTGGCATTTGAAGCTTTACACTTGA
BLAST of CmoCh02G006330 vs. Swiss-Prot
Match: CHX15_ARATH (Cation/H(+) antiporter 15 OS=Arabidopsis thaliana GN=CHX15 PE=2 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 2.5e-23 Identity = 50/64 (78.12%), Postives = 59/64 (92.19%), Query Frame = 1
BLAST of CmoCh02G006330 vs. Swiss-Prot
Match: CHX18_ARATH (Cation/H(+) antiporter 18 OS=Arabidopsis thaliana GN=CHX18 PE=2 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 1.4e-13 Identity = 35/65 (53.85%), Postives = 52/65 (80.00%), Query Frame = 1
BLAST of CmoCh02G006330 vs. Swiss-Prot
Match: CHX17_ARATH (Cation/H(+) antiporter 17 OS=Arabidopsis thaliana GN=CHX17 PE=1 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 4.0e-13 Identity = 34/57 (59.65%), Postives = 47/57 (82.46%), Query Frame = 1
BLAST of CmoCh02G006330 vs. Swiss-Prot
Match: CHX19_ARATH (Cation/H(+) antiporter 19 OS=Arabidopsis thaliana GN=CHX19 PE=2 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.1e-10 Identity = 29/57 (50.88%), Postives = 43/57 (75.44%), Query Frame = 1
BLAST of CmoCh02G006330 vs. Swiss-Prot
Match: CHX16_ARATH (Cation/H(+) antiporter 16 OS=Arabidopsis thaliana GN=CHX16 PE=2 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 5.5e-10 Identity = 28/50 (56.00%), Postives = 43/50 (86.00%), Query Frame = 1
BLAST of CmoCh02G006330 vs. TrEMBL
Match: A0A0A0LQ92_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G302270 PE=4 SV=1) HSP 1 Score: 126.3 bits (316), Expect = 1.7e-26 Identity = 62/73 (84.93%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of CmoCh02G006330 vs. TrEMBL
Match: A0A067KTC5_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_03679 PE=4 SV=1) HSP 1 Score: 118.6 bits (296), Expect = 3.5e-24 Identity = 57/73 (78.08%), Postives = 63/73 (86.30%), Query Frame = 1
BLAST of CmoCh02G006330 vs. TrEMBL
Match: W9QLT0_9ROSA (Cation/H(+) antiporter 15 OS=Morus notabilis GN=L484_020693 PE=4 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 1.3e-23 Identity = 56/65 (86.15%), Postives = 60/65 (92.31%), Query Frame = 1
BLAST of CmoCh02G006330 vs. TrEMBL
Match: A0A061DJ40_THECC (Cation/hydrogen exchanger 15 OS=Theobroma cacao GN=TCM_001511 PE=4 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 2.3e-23 Identity = 55/73 (75.34%), Postives = 63/73 (86.30%), Query Frame = 1
BLAST of CmoCh02G006330 vs. TrEMBL
Match: A0A068UNU9_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00030436001 PE=4 SV=1) HSP 1 Score: 115.5 bits (288), Expect = 3.0e-23 Identity = 54/72 (75.00%), Postives = 65/72 (90.28%), Query Frame = 1
BLAST of CmoCh02G006330 vs. TAIR10
Match: AT2G13620.1 (AT2G13620.1 cation/hydrogen exchanger 15) HSP 1 Score: 109.0 bits (271), Expect = 1.4e-24 Identity = 50/64 (78.12%), Postives = 59/64 (92.19%), Query Frame = 1
BLAST of CmoCh02G006330 vs. TAIR10
Match: AT5G41610.1 (AT5G41610.1 cation/H+ exchanger 18) HSP 1 Score: 76.6 bits (187), Expect = 7.8e-15 Identity = 35/65 (53.85%), Postives = 52/65 (80.00%), Query Frame = 1
BLAST of CmoCh02G006330 vs. TAIR10
Match: AT4G23700.1 (AT4G23700.1 cation/H+ exchanger 17) HSP 1 Score: 75.1 bits (183), Expect = 2.3e-14 Identity = 34/57 (59.65%), Postives = 47/57 (82.46%), Query Frame = 1
BLAST of CmoCh02G006330 vs. TAIR10
Match: AT3G17630.1 (AT3G17630.1 cation/H+ exchanger 19) HSP 1 Score: 67.0 bits (162), Expect = 6.2e-12 Identity = 29/57 (50.88%), Postives = 43/57 (75.44%), Query Frame = 1
BLAST of CmoCh02G006330 vs. TAIR10
Match: AT1G64170.1 (AT1G64170.1 cation/H+ exchanger 16) HSP 1 Score: 64.7 bits (156), Expect = 3.1e-11 Identity = 28/50 (56.00%), Postives = 43/50 (86.00%), Query Frame = 1
BLAST of CmoCh02G006330 vs. NCBI nr
Match: gi|449459268|ref|XP_004147368.1| (PREDICTED: cation/H(+) antiporter 15 [Cucumis sativus]) HSP 1 Score: 126.3 bits (316), Expect = 2.4e-26 Identity = 62/73 (84.93%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of CmoCh02G006330 vs. NCBI nr
Match: gi|659122215|ref|XP_008461025.1| (PREDICTED: cation/H(+) antiporter 15 [Cucumis melo]) HSP 1 Score: 126.3 bits (316), Expect = 2.4e-26 Identity = 62/73 (84.93%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of CmoCh02G006330 vs. NCBI nr
Match: gi|802585724|ref|XP_012070586.1| (PREDICTED: cation/H(+) antiporter 15 [Jatropha curcas]) HSP 1 Score: 118.6 bits (296), Expect = 5.1e-24 Identity = 57/73 (78.08%), Postives = 63/73 (86.30%), Query Frame = 1
BLAST of CmoCh02G006330 vs. NCBI nr
Match: gi|703078256|ref|XP_010090834.1| (Cation/H(+) antiporter 15 [Morus notabilis]) HSP 1 Score: 116.7 bits (291), Expect = 1.9e-23 Identity = 56/65 (86.15%), Postives = 60/65 (92.31%), Query Frame = 1
BLAST of CmoCh02G006330 vs. NCBI nr
Match: gi|590708940|ref|XP_007048418.1| (Cation/hydrogen exchanger 15 [Theobroma cacao]) HSP 1 Score: 115.9 bits (289), Expect = 3.3e-23 Identity = 55/73 (75.34%), Postives = 63/73 (86.30%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|