CmoCh01G009530 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGATCCAGAGGCTGCACGAACTGCTCGGGAATCGCTAGATCTTGCCTTTCATATTTCCAACATACTCAATACTGGAATTGATCGCCACACCCTCTCCGTCCTTATTGCTCTCTGTGACATGGGAGTGAACCCGGAGGCTCTAGCTGCTGTTGTTAAGGAACTACGTCAAGAGCCACCTTCATCGGAGGCCATCATCTCCAAGAACACGACATCACTTACCCGACCAACGTAA ATGGATCCAGAGGCTGCACGAACTGCTCGGGAATCGCTAGATCTTGCCTTTCATATTTCCAACATACTCAATACTGGAATTGATCGCCACACCCTCTCCGTCCTTATTGCTCTCTGTGACATGGGAGTGAACCCGGAGGCTCTAGCTGCTGTTGTTAAGGAACTACGTCAAGAGCCACCTTCATCGGAGGCCATCATCTCCAAGAACACGACATCACTTACCCGACCAACGTAA ATGGATCCAGAGGCTGCACGAACTGCTCGGGAATCGCTAGATCTTGCCTTTCATATTTCCAACATACTCAATACTGGAATTGATCGCCACACCCTCTCCGTCCTTATTGCTCTCTGTGACATGGGAGTGAACCCGGAGGCTCTAGCTGCTGTTGTTAAGGAACTACGTCAAGAGCCACCTTCATCGGAGGCCATCATCTCCAAGAACACGACATCACTTACCCGACCAACGTAA
BLAST of CmoCh01G009530 vs. Swiss-Prot
Match: MZT1B_ARATH (Mitotic-spindle organizing protein 1B OS=Arabidopsis thaliana GN=GIP1 PE=1 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.6e-19 Identity = 47/58 (81.03%), Postives = 54/58 (93.10%), Query Frame = 1
BLAST of CmoCh01G009530 vs. Swiss-Prot
Match: MZT1_PICSI (Mitotic-spindle organizing protein 1 OS=Picea sitchensis PE=3 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 5.1e-18 Identity = 46/58 (79.31%), Postives = 51/58 (87.93%), Query Frame = 1
BLAST of CmoCh01G009530 vs. Swiss-Prot
Match: MZT1A_ARATH (Mitotic-spindle organizing protein 1A OS=Arabidopsis thaliana GN=GIP2 PE=1 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 2.5e-17 Identity = 43/66 (65.15%), Postives = 55/66 (83.33%), Query Frame = 1
BLAST of CmoCh01G009530 vs. Swiss-Prot
Match: MZT1_TAEGU (Mitotic-spindle organizing protein 1 OS=Taeniopygia guttata GN=mzt1 PE=3 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 3.0e-10 Identity = 29/55 (52.73%), Postives = 43/55 (78.18%), Query Frame = 1
BLAST of CmoCh01G009530 vs. Swiss-Prot
Match: MZT1_MOUSE (Mitotic-spindle organizing protein 1 OS=Mus musculus GN=Mzt1 PE=1 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 5.1e-10 Identity = 35/75 (46.67%), Postives = 51/75 (68.00%), Query Frame = 1
BLAST of CmoCh01G009530 vs. TrEMBL
Match: A0A0A0LMZ6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G094370 PE=4 SV=1) HSP 1 Score: 119.8 bits (299), Expect = 1.5e-24 Identity = 59/69 (85.51%), Postives = 65/69 (94.20%), Query Frame = 1
BLAST of CmoCh01G009530 vs. TrEMBL
Match: A0A0D2TES9_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_008G288400 PE=4 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 2.4e-22 Identity = 55/70 (78.57%), Postives = 65/70 (92.86%), Query Frame = 1
BLAST of CmoCh01G009530 vs. TrEMBL
Match: B9T1I8_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0186670 PE=4 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 2.4e-22 Identity = 55/65 (84.62%), Postives = 63/65 (96.92%), Query Frame = 1
BLAST of CmoCh01G009530 vs. TrEMBL
Match: A0A0B2PDD0_GLYSO (Mitotic-spindle organizing protein 1B OS=Glycine soja GN=glysoja_038443 PE=4 SV=1) HSP 1 Score: 111.7 bits (278), Expect = 4.0e-22 Identity = 57/73 (78.08%), Postives = 65/73 (89.04%), Query Frame = 1
BLAST of CmoCh01G009530 vs. TrEMBL
Match: I1J6X9_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_01G100100 PE=4 SV=1) HSP 1 Score: 111.7 bits (278), Expect = 4.0e-22 Identity = 57/73 (78.08%), Postives = 65/73 (89.04%), Query Frame = 1
BLAST of CmoCh01G009530 vs. TAIR10
Match: AT4G09550.1 (AT4G09550.1 AtGCP3 interacting protein 1) HSP 1 Score: 96.3 bits (238), Expect = 8.9e-21 Identity = 47/58 (81.03%), Postives = 54/58 (93.10%), Query Frame = 1
BLAST of CmoCh01G009530 vs. TAIR10
Match: AT1G73790.1 (AT1G73790.1 Protein of unknown function (DUF3743)) HSP 1 Score: 89.0 bits (219), Expect = 1.4e-18 Identity = 43/66 (65.15%), Postives = 55/66 (83.33%), Query Frame = 1
BLAST of CmoCh01G009530 vs. NCBI nr
Match: gi|778668078|ref|XP_011649034.1| (PREDICTED: mitotic-spindle organizing protein 1A-like [Cucumis sativus]) HSP 1 Score: 119.8 bits (299), Expect = 2.1e-24 Identity = 59/69 (85.51%), Postives = 65/69 (94.20%), Query Frame = 1
BLAST of CmoCh01G009530 vs. NCBI nr
Match: gi|659082266|ref|XP_008441751.1| (PREDICTED: mitotic-spindle organizing protein 1A-like [Cucumis melo]) HSP 1 Score: 118.6 bits (296), Expect = 4.7e-24 Identity = 59/69 (85.51%), Postives = 65/69 (94.20%), Query Frame = 1
BLAST of CmoCh01G009530 vs. NCBI nr
Match: gi|1000941381|ref|XP_015582673.1| (PREDICTED: mitotic-spindle organizing protein 1A [Ricinus communis]) HSP 1 Score: 112.5 bits (280), Expect = 3.4e-22 Identity = 55/65 (84.62%), Postives = 63/65 (96.92%), Query Frame = 1
BLAST of CmoCh01G009530 vs. NCBI nr
Match: gi|823215102|ref|XP_012440309.1| (PREDICTED: mitotic-spindle organizing protein 1B-like [Gossypium raimondii]) HSP 1 Score: 112.5 bits (280), Expect = 3.4e-22 Identity = 55/70 (78.57%), Postives = 65/70 (92.86%), Query Frame = 1
BLAST of CmoCh01G009530 vs. NCBI nr
Match: gi|763785935|gb|KJB53006.1| (hypothetical protein B456_008G288400 [Gossypium raimondii]) HSP 1 Score: 112.5 bits (280), Expect = 3.4e-22 Identity = 55/70 (78.57%), Postives = 65/70 (92.86%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|