Cla97C10G191580 (gene) Watermelon (97103) v2
The following sequences are available for this feature:
Legend: polypeptideexonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAAACTTTTGCATTTTGATCAACATGGCTGTACTGTAAGTGGACTGGATTTATGTGTTTAAACTGACTACGACCAAAGTAGTGGCTACTTCAACCAAAAAAAGGGCGACCCCTTTTCAAACCGAAAGAAGTACCTCACCTCACTTACGAAGAAGTAGTTGGAGCTGGGCTCCGAACTATGAGAGTTTGCTTTTCTTTCATTTTCTAAGAGCGGTCTGACCCCTTATTTGATCAGACCGCTCCTGGTCTTCGAACTAGTCATTAATGGTCGGCTTCATTGGTATCTTTTCGGTATGCGTTCCGAACACTTTCATTTTTAGCGTCTCATCTTCTCTAGATATACGATATATCTGGTGTGGAAGTCGGCCAACATTTGTATTGGCAAATAGGAGGTTTCCAAGTGCATGCCCAAGTACTTATTACTTCTTGGGTTGTAATTGCTATCTTATTAGGTTCAGCCATTATAGCTGTTCGTAATCCACAAACCATTCCTACTGACGGTCAGAATTTCTTCGAATATGTCCTTGAATTCATTCGAGACGTGAGCAAAACTCAGATTGGCGAAGAATATGGTCCATGGGTTCCCTTTATTGGAACTATGTTTCTATTTATTTTTGTTTCGAATTGGTCAGGGGCTCTTTTACCTTGGAAAATCATACAGTTACCTCACGGAGAGTTAGCCGCACCCACAAATGATATAAATACTACTGTTGCTTTAGCTTTACTCACATCAGTAGCATATTTCTATGCGGGTCTTAGCAAAAAAGGATTAAGTTATTTCGGTAAATACATAAGAAGGGCCTTATCGCAAAAAGTCTCTTTGAAAGGTCACTCTCATTAA ATGAAACTTTTGCATTTTGATCAACATGGCTGTACTATATACGATATATCTGGTGTGGAAGTCGGCCAACATTTGTATTGGCAAATAGGAGGTTTCCAAGTGCATGCCCAAGTACTTATTACTTCTTGGGTTGTAATTGCTATCTTATTAGGTTCAGCCATTATAGCTGTTCGTAATCCACAAACCATTCCTACTGACGGTCAGAATTTCTTCGAATATGTCCTTGAATTCATTCGAGACGTGAGCAAAACTCAGATTGGCGAAGAATATGGTCCATGGGTTCCCTTTATTGGAACTATGTTTCTATTTATTTTTGTTTCGAATTGGTCAGGGGCTCTTTTACCTTGGAAAATCATACAGTTACCTCACGGAGAGTTAGCCGCACCCACAAATGATATAAATACTACTGTTGCTTTAGCTTTACTCACATCAGTAGCATATTTCTATGCGGGTCTTAGCAAAAAAGGATTAAGTTATTTCGGTAAATACATAAGAAGGGCCTTATCGCAAAAAGTCTCTTTGAAAGGTCACTCTCATTAA ATGAAACTTTTGCATTTTGATCAACATGGCTGTACTATATACGATATATCTGGTGTGGAAGTCGGCCAACATTTGTATTGGCAAATAGGAGGTTTCCAAGTGCATGCCCAAGTACTTATTACTTCTTGGGTTGTAATTGCTATCTTATTAGGTTCAGCCATTATAGCTGTTCGTAATCCACAAACCATTCCTACTGACGGTCAGAATTTCTTCGAATATGTCCTTGAATTCATTCGAGACGTGAGCAAAACTCAGATTGGCGAAGAATATGGTCCATGGGTTCCCTTTATTGGAACTATGTTTCTATTTATTTTTGTTTCGAATTGGTCAGGGGCTCTTTTACCTTGGAAAATCATACAGTTACCTCACGGAGAGTTAGCCGCACCCACAAATGATATAAATACTACTGTTGCTTTAGCTTTACTCACATCAGTAGCATATTTCTATGCGGGTCTTAGCAAAAAAGGATTAAGTTATTTCGGTAAATACATAAGAAGGGCCTTATCGCAAAAAGTCTCTTTGAAAGGTCACTCTCATTAA MKLLHFDQHGCTIYDISGVEVGQHLYWQIGGFQVHAQVLITSWVVIAILLGSAIIAVRNPQTIPTDGQNFFEYVLEFIRDVSKTQIGEEYGPWVPFIGTMFLFIFVSNWSGALLPWKIIQLPHGELAAPTNDINTTVALALLTSVAYFYAGLSKKGLSYFGKYIRRALSQKVSLKGHSH
BLAST of Cla97C10G191580 vs. NCBI nr
Match: YP_247587.1 (ATP synthase CF0 A subunit [Cucumis sativus] >YP_004841771.1 ATP synthase CF0 subunit IV [Cucumis melo subsp. melo] >YP_009004032.1 ATP synthase CF0 subunit IV [Cucumis hystrix] >YP_009317374.1 ATP synthase CF0 A subunit (chloroplast) [Coccinia grandis] >YP_009325977.1 ATP synthase CF0 A subunit (chloroplast) [Citrullus lanatus] >YP_009346473.1 ATP synthase CF0 subunit IV (chloroplast) [Cucumis x hytivus] >YP_009348019.1 ATP synthase CF0 A subunit (plastid) [Citrullus mucosospermus] >YP_009420782.1 ATP synthase CF0 A subunit (chloroplast) [Citrullus colocynthis] >YP_009431545.1 ATP synthase CF0 A subunit (chloroplast) [Citrullus amarus] >YP_009431630.1 ATP synthase CF0 A subunit (chloroplast) [Citrullus rehmii] >YP_009447438.1 ATP synthase CF0 A subunit (chloroplast) [Cucurbita maxima] >YP_009447523.1 ATP synthase CF0 A subunit (chloroplast) [Cucurbita moschata] >YP_009456134.1 ATP synthase CF0 A subunit (chloroplast) [Lagenaria siceraria] >YP_009505068.1 ATP synthase CF0 A subunit (chloroplast) [Cucurbita pepo] >Q4VZP5.1 RecName: Full=ATP synthase subunit a, chloroplastic; AltName: Full=ATP synthase F0 sector subunit a; AltName: Full=F-ATPase subunit IV >CAJ00746.1 ATP synthase CF0 A chain (chloroplast) [Cucumis sativus] >ABI97405.1 ATP synthase CF0 subunit IV (chloroplast) [Cucumis sativus] >ABI98733.1 ATP synthase CF0 subunit IV (chloroplast) [Cucumis sativus] >AEM76880.1 ATP synthase CF0 subunit IV (chloroplast) [Cucumis melo subsp. melo] >AHJ61374.1 ATP synthase CF0 subunit IV (plastid) [Cucumis hystrix] >AHM88701.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM88760.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM88933.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM88991.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89050.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89109.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89168.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89227.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89286.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89346.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89405.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89464.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89523.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89583.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89642.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89701.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89760.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89819.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89878.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89937.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM89996.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90055.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90114.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90173.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90232.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90291.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90350.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90409.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90468.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90527.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90586.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90645.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90704.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90763.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90822.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90881.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90940.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM90999.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM91058.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >AHM91291.1 ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria] >ALF03289.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis sativus var. hardwickii] >ALO21717.1 AtpI (plastid) [Cucurbita argyrosperma] >ALO21828.1 AtpI (plastid) [Cucurbita argyrosperma var. palmeri] >ALO21869.1 AtpI (plastid) [Cucurbita argyrosperma subsp. sororia] >ALO21942.1 AtpI (plastid) [Cucurbita cordata] >ALO22020.1 AtpI (plastid) [Cucurbita digitata] >ALO22064.1 AtpI (plastid) [Cucurbita ecuadorensis] >ALO22212.1 AtpI (plastid) [Cucurbita foetidissima] >ALO22251.1 AtpI (plastid) [Cucurbita lundelliana] >ALO22285.1 AtpI (plastid) [Cucurbita maxima subsp. andreana] >ALO22398.1 AtpI (plastid) [Cucurbita moschata] >ALO22450.1 AtpI (plastid) [Cucurbita okeechobeensis] >ALO22484.1 AtpI (plastid) [Cucurbita okeechobeensis subsp. martinezii] >ALO22591.1 AtpI (plastid) [Cucurbita pepo subsp. fraterna] >ALO22666.1 AtpI (plastid) [Cucurbita pepo subsp. ovifera] >ALO22677.1 AtpI (plastid) [Cucurbita pepo var. ozarkana] >ALO22769.1 AtpI (plastid) [Cucurbita pepo subsp. pepo] >ALO22804.1 AtpI (plastid) [Cucurbita pepo var. texana] >ALO22870.1 AtpI (plastid) [Cucurbita pedatifolia] >ANF28365.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis sativus var. hardwickii] >AOW71083.1 ATP synthase CF0 subunit IV (chloroplast) [Cucumis x hytivus] >AOX48747.1 ATP synthase CF0 A subunit (chloroplast) [Coccinia grandis] >AOX48832.1 ATP synthase CF0 A subunit (chloroplast) [Coccinia grandis] >APD52468.1 ATP synthase CF0 A subunit (chloroplast) [Citrullus lanatus] >APW82449.1 ATP synthase CF0 A subunit (plastid) [Citrullus lanatus subsp. vulgaris] >APW82534.1 ATP synthase CF0 A subunit (plastid) [Citrullus lanatus subsp. vulgaris] >APW82619.1 ATP synthase CF0 A subunit (plastid) [Citrullus lanatus subsp. vulgaris] >APW82704.1 ATP synthase CF0 A subunit (plastid) [Citrullus mucosospermus] >APW82789.1 ATP synthase CF0 A subunit (plastid) [Citrullus mucosospermus] >APW82874.1 ATP synthase CF0 A subunit (plastid) [Citrullus lanatus subsp. vulgaris] >APW82959.1 ATP synthase CF0 A subunit (plastid) [Citrullus lanatus subsp. vulgaris] >APW83044.1 ATP synthase CF0 A subunit (plastid) [Citrullus lanatus subsp. vulgaris] >APW83129.1 ATP synthase CF0 A subunit (plastid) [Citrullus lanatus subsp. vulgaris] >APW83214.1 ATP synthase CF0 A subunit (plastid) [Citrullus lanatus subsp. vulgaris] >APW83299.1 ATP synthase CF0 A subunit (plastid) [Citrullus mucosospermus] >ARQ16066.1 ATP synthase CF0 subunit IV (chloroplast) [Cucumis sativus] >ARQ16149.1 ATP synthase CF0 subunit IV (chloroplast) [Cucumis sativus] >ARQ16232.1 ATP synthase CF0 subunit IV (chloroplast) [Cucumis sativus] >ARQ16315.1 ATP synthase CF0 subunit IV (chloroplast) [Cucumis sativus] >ASP44497.1 ATP synthase CF0 A subunit (chloroplast) [Citrullus colocynthis] >ASY96195.1 ATP synthase CF0 A subunit (chloroplast) [Citrullus amarus] >ASY96283.1 ATP synthase CF0 A subunit (chloroplast) [Citrullus rehmii] >ASY96367.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis melo subsp. agrestis] >ASY96453.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis melo subsp. agrestis] >ASY96540.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis melo subsp. agrestis] >ASY96626.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis melo var. conomon] >ASY96714.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis melo var. makuwa] >ASY96802.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis melo var. momordica] >ASY96888.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis melo var. dudaim] >ASY96976.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis melo var. cantalupo] >ASY97063.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis melo var. cantalupo] >ASY97149.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis melo var. inodorus] >ASY97237.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis melo var. cantalupo] >ASY97324.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis melo var. flexuosus] >ASY97411.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis melo var. flexuosus] >ASY97499.1 ATP synthase CF0 A subunit (chloroplast) [Cucumis sativus var. hardwickii] >ATY69904.1 ATP synthase CF0 A subunit (chloroplast) [Cucurbita maxima] >ATY69987.1 ATP synthase CF0 A subunit (chloroplast) [Cucurbita moschata] >AUJ21900.1 ATP synthase CF0 A subunit (chloroplast) [Lagenaria siceraria] >AVE15319.1 AtpI (chloroplast) [Cucumis sativus var. sativus] >AWX90382.1 ATP synthase CF0 A subunit (chloroplast) [Cucurbita pepo]) HSP 1 Score: 310.8 bits (795), Expect = 2.9e-81 Identity = 151/153 (98.69%), Postives = 153/153 (100.00%), Query Frame = 0
BLAST of Cla97C10G191580 vs. NCBI nr
Match: AHM88818.1 (ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria]) HSP 1 Score: 310.8 bits (795), Expect = 2.9e-81 Identity = 151/153 (98.69%), Postives = 153/153 (100.00%), Query Frame = 0
BLAST of Cla97C10G191580 vs. NCBI nr
Match: AHM91116.1 (ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria]) HSP 1 Score: 310.8 bits (795), Expect = 2.9e-81 Identity = 151/153 (98.69%), Postives = 153/153 (100.00%), Query Frame = 0
BLAST of Cla97C10G191580 vs. NCBI nr
Match: AHM91176.1 (ATP synthase CF0 subunit IV (chloroplast) [Lagenaria siceraria]) HSP 1 Score: 310.8 bits (795), Expect = 2.9e-81 Identity = 151/153 (98.69%), Postives = 153/153 (100.00%), Query Frame = 0
BLAST of Cla97C10G191580 vs. NCBI nr
Match: AXR94513.1 (ATP synthase CF0 subunit IV (chloroplast) [Hodgsonia macrocarpa] >AXR94598.1 ATP synthase CF0 subunit IV (chloroplast) [Hodgsonia macrocarpa] >AXR94682.1 ATP synthase CF0 subunit IV (chloroplast) [Hodgsonia macrocarpa] >AXR94767.1 ATP synthase CF0 subunit IV (chloroplast) [Hodgsonia macrocarpa]) HSP 1 Score: 310.5 bits (794), Expect = 3.8e-81 Identity = 150/153 (98.04%), Postives = 153/153 (100.00%), Query Frame = 0
BLAST of Cla97C10G191580 vs. TrEMBL
Match: tr|X2F3A5|X2F3A5_LAGSI (ATP synthase subunit a, chloroplastic OS=Lagenaria siceraria OX=3668 GN=atpI PE=3 SV=1) HSP 1 Score: 310.8 bits (795), Expect = 1.9e-81 Identity = 151/153 (98.69%), Postives = 153/153 (100.00%), Query Frame = 0
BLAST of Cla97C10G191580 vs. TrEMBL
Match: tr|A0A249RY45|A0A249RY45_CUCME (ATP synthase subunit a, chloroplastic OS=Cucumis melo subsp. agrestis OX=217619 GN=atpI PE=3 SV=1) HSP 1 Score: 310.8 bits (795), Expect = 1.9e-81 Identity = 151/153 (98.69%), Postives = 153/153 (100.00%), Query Frame = 0
BLAST of Cla97C10G191580 vs. TrEMBL
Match: tr|A0A286NG22|A0A286NG22_CUCME (ATP synthase subunit a, chloroplastic OS=Cucumis melo var. flexuosus OX=1120798 GN=atpI PE=3 SV=1) HSP 1 Score: 310.8 bits (795), Expect = 1.9e-81 Identity = 151/153 (98.69%), Postives = 153/153 (100.00%), Query Frame = 0
BLAST of Cla97C10G191580 vs. TrEMBL
Match: tr|A0A0S2IFL4|A0A0S2IFL4_CUCMO (ATP synthase CF0 A subunit OS=Cucurbita moschata OX=3662 GN=atpI PE=3 SV=1) HSP 1 Score: 310.8 bits (795), Expect = 1.9e-81 Identity = 151/153 (98.69%), Postives = 153/153 (100.00%), Query Frame = 0
BLAST of Cla97C10G191580 vs. TrEMBL
Match: tr|A0A1P8LDG1|A0A1P8LDG1_CITLA (ATP synthase CF0 A subunit OS=Citrullus lanatus subsp. vulgaris OX=260674 GN=atpI PE=3 SV=1) HSP 1 Score: 310.8 bits (795), Expect = 1.9e-81 Identity = 151/153 (98.69%), Postives = 153/153 (100.00%), Query Frame = 0
BLAST of Cla97C10G191580 vs. Swiss-Prot
Match: sp|Q4VZP5|ATPI_CUCSA (ATP synthase subunit a, chloroplastic OS=Cucumis sativus OX=3659 GN=atpI PE=3 SV=1) HSP 1 Score: 310.8 bits (795), Expect = 9.6e-84 Identity = 151/153 (98.69%), Postives = 153/153 (100.00%), Query Frame = 0
BLAST of Cla97C10G191580 vs. Swiss-Prot
Match: sp|Q09X29|ATPI_MORIN (ATP synthase subunit a, chloroplastic OS=Morus indica OX=248361 GN=atpI PE=3 SV=1) HSP 1 Score: 304.3 bits (778), Expect = 9.0e-82 Identity = 146/153 (95.42%), Postives = 152/153 (99.35%), Query Frame = 0
BLAST of Cla97C10G191580 vs. Swiss-Prot
Match: sp|A6MM24|ATPI_BUXMI (ATP synthase subunit a, chloroplastic OS=Buxus microphylla OX=153571 GN=atpI PE=3 SV=1) HSP 1 Score: 303.5 bits (776), Expect = 1.5e-81 Identity = 146/153 (95.42%), Postives = 150/153 (98.04%), Query Frame = 0
BLAST of Cla97C10G191580 vs. Swiss-Prot
Match: sp|Q4FGF5|ATPI_RANMC (ATP synthase subunit a, chloroplastic OS=Ranunculus macranthus OX=334596 GN=atpI PE=3 SV=1) HSP 1 Score: 300.8 bits (769), Expect = 9.9e-81 Identity = 145/153 (94.77%), Postives = 149/153 (97.39%), Query Frame = 0
BLAST of Cla97C10G191580 vs. Swiss-Prot
Match: sp|Q0ZJ32|ATPI_VITVI (ATP synthase subunit a, chloroplastic OS=Vitis vinifera OX=29760 GN=atpI PE=3 SV=1) HSP 1 Score: 300.8 bits (769), Expect = 9.9e-81 Identity = 145/153 (94.77%), Postives = 149/153 (97.39%), Query Frame = 0
BLAST of Cla97C10G191580 vs. TAIR10
Match: ATCG00150.1 (ATPase, F0 complex, subunit A protein) HSP 1 Score: 296.6 bits (758), Expect = 1.0e-80 Identity = 141/153 (92.16%), Postives = 149/153 (97.39%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of watermelon 97103 v2
Date Performed: 2019-05-12
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|