Cla97C07G133910 (gene) Watermelon (97103) v2
The following sequences are available for this feature:
Legend: polypeptideCDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGTCTCATCACGCAGACCATCGATTTGCTAGAATTGTGAAAGAAAATGAAAACCTTCGAACAGACCCACCATCCAATTGCAGTGCTGGGATTGTTAATGATAGTGATTTTAACCAATGGAAAGCAACCATAATTGGACCTGAAAGCAGCCCTTATGAAGGAGGTTTATTCAAACTTTCTATATTTCTTCCTCCTGATTATCCAATGAAGCCACCAAAAGTTACGTTCATAACAAAAATTTATCATCCTAATATCAACAGCACAGGAAGCATTTGCCTTGATCTTCTCAACCAAAATTGGAGTGCTGCTAATACAATATCAAGTGTTTTGATTTCTATTTGCTCTTTGTTGACTGATCCAAACCCTGATGATCCACTTGATTTAGAGATTGCTAAGCTTTATAAGGAGAATAGACCTCAGTTTGAGATCACTGCTCGTCAATGGACTGAAAAGTTTGCTCGTTAG ATGTCTCATCACGCAGACCATCGATTTGCTAGAATTGTGAAAGAAAATGAAAACCTTCGAACAGACCCACCATCCAATTGCAGTGCTGGGATTGTTAATGATAGTGATTTTAACCAATGGAAAGCAACCATAATTGGACCTGAAAGCAGCCCTTATGAAGGAGGTTTATTCAAACTTTCTATATTTCTTCCTCCTGATTATCCAATGAAGCCACCAAAAGTTACGTTCATAACAAAAATTTATCATCCTAATATCAACAGCACAGGAAGCATTTGCCTTGATCTTCTCAACCAAAATTGGAGTGCTGCTAATACAATATCAAGTGTTTTGATTTCTATTTGCTCTTTGTTGACTGATCCAAACCCTGATGATCCACTTGATTTAGAGATTGCTAAGCTTTATAAGGAGAATAGACCTCAGTTTGAGATCACTGCTCGTCAATGGACTGAAAAGTTTGCTCGTTAG ATGTCTCATCACGCAGACCATCGATTTGCTAGAATTGTGAAAGAAAATGAAAACCTTCGAACAGACCCACCATCCAATTGCAGTGCTGGGATTGTTAATGATAGTGATTTTAACCAATGGAAAGCAACCATAATTGGACCTGAAAGCAGCCCTTATGAAGGAGGTTTATTCAAACTTTCTATATTTCTTCCTCCTGATTATCCAATGAAGCCACCAAAAGTTACGTTCATAACAAAAATTTATCATCCTAATATCAACAGCACAGGAAGCATTTGCCTTGATCTTCTCAACCAAAATTGGAGTGCTGCTAATACAATATCAAGTGTTTTGATTTCTATTTGCTCTTTGTTGACTGATCCAAACCCTGATGATCCACTTGATTTAGAGATTGCTAAGCTTTATAAGGAGAATAGACCTCAGTTTGAGATCACTGCTCGTCAATGGACTGAAAAGTTTGCTCGTTAG MSHHADHRFARIVKENENLRTDPPSNCSAGIVNDSDFNQWKATIIGPESSPYEGGLFKLSIFLPPDYPMKPPKVTFITKIYHPNINSTGSICLDLLNQNWSAANTISSVLISICSLLTDPNPDDPLDLEIAKLYKENRPQFEITARQWTEKFAR
BLAST of Cla97C07G133910 vs. NCBI nr
Match: XP_022157782.1 (ubiquitin-conjugating enzyme E2 11-like [Momordica charantia]) HSP 1 Score: 243.4 bits (620), Expect = 4.9e-61 Identity = 110/153 (71.90%), Postives = 133/153 (86.93%), Query Frame = 0
BLAST of Cla97C07G133910 vs. NCBI nr
Match: KOO30464.1 (ubiquitin conjugating enzyme [Chrysochromulina sp. CCMP291]) HSP 1 Score: 202.2 bits (513), Expect = 1.3e-48 Identity = 95/143 (66.43%), Postives = 114/143 (79.72%), Query Frame = 0
BLAST of Cla97C07G133910 vs. NCBI nr
Match: OAD00687.1 (hypothetical protein MUCCIDRAFT_30166 [Mucor circinelloides f. lusitanicus CBS 277.49]) HSP 1 Score: 198.7 bits (504), Expect = 1.4e-47 Identity = 94/143 (65.73%), Postives = 111/143 (77.62%), Query Frame = 0
BLAST of Cla97C07G133910 vs. NCBI nr
Match: GBG80014.1 (hypothetical protein CBR_g30275 [Chara braunii]) HSP 1 Score: 198.7 bits (504), Expect = 1.4e-47 Identity = 93/143 (65.03%), Postives = 113/143 (79.02%), Query Frame = 0
BLAST of Cla97C07G133910 vs. NCBI nr
Match: NP_566331.1 (ubiquitin-conjugating enzyme 11 [Arabidopsis thaliana] >NP_001189841.1 ubiquitin-conjugating enzyme 11 [Arabidopsis thaliana] >XP_020888570.1 ubiquitin-conjugating enzyme E2 11 [Arabidopsis lyrata subsp. lyrata] >XP_020888571.1 ubiquitin-conjugating enzyme E2 11 [Arabidopsis lyrata subsp. lyrata] >XP_020888572.1 ubiquitin-conjugating enzyme E2 11 [Arabidopsis lyrata subsp. lyrata] >P35134.2 RecName: Full=Ubiquitin-conjugating enzyme E2 11; AltName: Full=E2 ubiquitin-conjugating enzyme 11; AltName: Full=Ubiquitin carrier protein 11; AltName: Full=Ubiquitin-conjugating enzyme E2-17 kDa 11; AltName: Full=Ubiquitin-protein ligase 11 >AAG51362.1 putative ubiquitin conjugating enzyme; 52410-53412 [Arabidopsis thaliana] >AAL36225.1 putative E2, ubiquitin-conjugating enzyme UBC11 [Arabidopsis thaliana] >AAM14162.1 putative ubiquitin conjugating enzyme 11 (UBC11) [Arabidopsis thaliana] >AAM63316.1 E2, ubiquitin-conjugating enzyme UBC11 [Arabidopsis thaliana] >AAY44851.1 ubiquitinating enzyme [Arabidopsis thaliana] >BAF00202.1 putative ubiquitin conjugating enzyme [Arabidopsis thaliana] >EFH58839.1 ubiquitin-conjugating enzyme 11 [Arabidopsis lyrata subsp. lyrata] >AEE74664.1 ubiquitin-conjugating enzyme 11 [Arabidopsis thaliana] >AEE74665.1 ubiquitin-conjugating enzyme 11 [Arabidopsis thaliana]) HSP 1 Score: 198.0 bits (502), Expect = 2.4e-47 Identity = 94/143 (65.73%), Postives = 115/143 (80.42%), Query Frame = 0
BLAST of Cla97C07G133910 vs. TrEMBL
Match: tr|A0A0M0JVC0|A0A0M0JVC0_9EUKA (Ubiquitin conjugating enzyme OS=Chrysochromulina sp. CCMP291 OX=1460289 GN=Ctob_011742 PE=3 SV=1) HSP 1 Score: 202.2 bits (513), Expect = 8.4e-49 Identity = 95/143 (66.43%), Postives = 114/143 (79.72%), Query Frame = 0
BLAST of Cla97C07G133910 vs. TrEMBL
Match: tr|A0A162YU99|A0A162YU99_MUCCL (Uncharacterized protein OS=Mucor circinelloides f. lusitanicus CBS 277.49 OX=747725 GN=MUCCIDRAFT_30166 PE=3 SV=1) HSP 1 Score: 198.7 bits (504), Expect = 9.2e-48 Identity = 94/143 (65.73%), Postives = 111/143 (77.62%), Query Frame = 0
BLAST of Cla97C07G133910 vs. TrEMBL
Match: tr|D7L769|D7L769_ARALL (Ubiquitin-conjugating enzyme 11 OS=Arabidopsis lyrata subsp. lyrata OX=81972 GN=UBC11 PE=3 SV=1) HSP 1 Score: 198.0 bits (502), Expect = 1.6e-47 Identity = 94/143 (65.73%), Postives = 115/143 (80.42%), Query Frame = 0
BLAST of Cla97C07G133910 vs. TrEMBL
Match: tr|R0I184|R0I184_9BRAS (Uncharacterized protein OS=Capsella rubella OX=81985 GN=CARUB_v10014842mg PE=3 SV=1) HSP 1 Score: 197.6 bits (501), Expect = 2.1e-47 Identity = 93/143 (65.03%), Postives = 115/143 (80.42%), Query Frame = 0
BLAST of Cla97C07G133910 vs. TrEMBL
Match: tr|B5A4L9|B5A4L9_GYMST (Ubiquitin-conjugating enzyme 2 OS=Gymnochlora stellata OX=67809 PE=2 SV=1) HSP 1 Score: 197.2 bits (500), Expect = 2.7e-47 Identity = 94/144 (65.28%), Postives = 111/144 (77.08%), Query Frame = 0
BLAST of Cla97C07G133910 vs. Swiss-Prot
Match: sp|P35134|UBC11_ARATH (Ubiquitin-conjugating enzyme E2 11 OS=Arabidopsis thaliana OX=3702 GN=UBC11 PE=1 SV=2) HSP 1 Score: 198.0 bits (502), Expect = 7.8e-50 Identity = 94/143 (65.73%), Postives = 115/143 (80.42%), Query Frame = 0
BLAST of Cla97C07G133910 vs. Swiss-Prot
Match: sp|P35135|UBC4_SOLLC (Ubiquitin-conjugating enzyme E2-17 kDa OS=Solanum lycopersicum OX=4081 PE=2 SV=1) HSP 1 Score: 193.4 bits (490), Expect = 1.9e-48 Identity = 91/143 (63.64%), Postives = 114/143 (79.72%), Query Frame = 0
BLAST of Cla97C07G133910 vs. Swiss-Prot
Match: sp|P35131|UBC8_ARATH (Ubiquitin-conjugating enzyme E2 8 OS=Arabidopsis thaliana OX=3702 GN=UBC8 PE=1 SV=1) HSP 1 Score: 192.6 bits (488), Expect = 3.3e-48 Identity = 90/143 (62.94%), Postives = 114/143 (79.72%), Query Frame = 0
BLAST of Cla97C07G133910 vs. Swiss-Prot
Match: sp|Q94F47|UBC28_ARATH (Ubiquitin-conjugating enzyme E2 28 OS=Arabidopsis thaliana OX=3702 GN=UBC28 PE=1 SV=1) HSP 1 Score: 192.2 bits (487), Expect = 4.3e-48 Identity = 89/143 (62.24%), Postives = 114/143 (79.72%), Query Frame = 0
BLAST of Cla97C07G133910 vs. Swiss-Prot
Match: sp|P35133|UBC10_ARATH (Ubiquitin-conjugating enzyme E2 10 OS=Arabidopsis thaliana OX=3702 GN=UBC10 PE=1 SV=1) HSP 1 Score: 190.7 bits (483), Expect = 1.2e-47 Identity = 89/143 (62.24%), Postives = 114/143 (79.72%), Query Frame = 0
BLAST of Cla97C07G133910 vs. TAIR10
Match: AT3G08690.1 (ubiquitin-conjugating enzyme 11) HSP 1 Score: 198.0 bits (502), Expect = 4.3e-51 Identity = 94/143 (65.73%), Postives = 115/143 (80.42%), Query Frame = 0
BLAST of Cla97C07G133910 vs. TAIR10
Match: AT4G27960.2 (ubiquitin conjugating enzyme 9) HSP 1 Score: 190.7 bits (483), Expect = 6.9e-49 Identity = 89/143 (62.24%), Postives = 114/143 (79.72%), Query Frame = 0
BLAST of Cla97C07G133910 vs. TAIR10
Match: AT5G53300.1 (ubiquitin-conjugating enzyme 10) HSP 1 Score: 190.7 bits (483), Expect = 6.9e-49 Identity = 89/143 (62.24%), Postives = 114/143 (79.72%), Query Frame = 0
BLAST of Cla97C07G133910 vs. TAIR10
Match: AT5G56150.1 (ubiquitin-conjugating enzyme 30) HSP 1 Score: 188.7 bits (478), Expect = 2.6e-48 Identity = 89/143 (62.24%), Postives = 110/143 (76.92%), Query Frame = 0
BLAST of Cla97C07G133910 vs. TAIR10
Match: AT5G41700.4 (ubiquitin conjugating enzyme 8) HSP 1 Score: 185.7 bits (470), Expect = 2.2e-47 Identity = 89/144 (61.81%), Postives = 113/144 (78.47%), Query Frame = 0
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of watermelon 97103 v2
Date Performed: 2019-05-12
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |