Cla017398 (gene) Watermelon (97103) v1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGCCTCGCTTCTTCTCCGGTCTCCTTCCCCATGGATTTTTTAACGCTCTCATCGGGTATTTATATATCTATCAAAAACAAATTATTAAAGATCCCCAACCCTTTATAATTTTTAAAGATTTTTTCTTTCTTTTCCTTTAATAAAAATTTAGTTTTAACGTGGTGTGCTTGGACAGGCGTGGATATACGGCGGAATCAATGGCGGCATCACAAAGAGTGGCGTCTAGCGCGGCGGCGGAAGTAGTTCCGGCACGAACCCACATAATGATGAAGAAAGAAGAAGCAGAAATAAGTACGGAGAAGGCGGCGTGGGTACCAGACCCTGTCACCGGCTACTACCGGCCGGAGAATTACGCCGATGAGATCGACGCCGTGGATCTTCGTGCTAAGCTATTGAAGCCGAGAGGAAATATAATCAATTAA ATGCCTCGCTTCTTCTCCGGTCTCCTTCCCCATGGATTTTTTAACGCTCTCATCGGGCGTGGATATACGGCGGAATCAATGGCGGCATCACAAAGAGTGGCGTCTAGCGCGGCGGCGGAAGTAGTTCCGGCACGAACCCACATAATGATGAAGAAAGAAGAAGCAGAAATAAGTACGGAGAAGGCGGCGTGGGTACCAGACCCTGTCACCGGCTACTACCGGCCGGAGAATTACGCCGATGAGATCGACGCCGTGGATCTTCGTGCTAAGCTATTGAAGCCGAGAGGAAATATAATCAATTAA ATGCCTCGCTTCTTCTCCGGTCTCCTTCCCCATGGATTTTTTAACGCTCTCATCGGGCGTGGATATACGGCGGAATCAATGGCGGCATCACAAAGAGTGGCGTCTAGCGCGGCGGCGGAAGTAGTTCCGGCACGAACCCACATAATGATGAAGAAAGAAGAAGCAGAAATAAGTACGGAGAAGGCGGCGTGGGTACCAGACCCTGTCACCGGCTACTACCGGCCGGAGAATTACGCCGATGAGATCGACGCCGTGGATCTTCGTGCTAAGCTATTGAAGCCGAGAGGAAATATAATCAATTAA MPRFFSGLLPHGFFNALIGRGYTAESMAASQRVASSAAAEVVPARTHIMMKKEEAEISTEKAAWVPDPVTGYYRPENYADEIDAVDLRAKLLKPRGNIIN
BLAST of Cla017398 vs. Swiss-Prot
Match: SAG21_ARATH (Protein SENESCENCE-ASSOCIATED GENE 21, mitochondrial OS=Arabidopsis thaliana GN=SAG21 PE=2 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 2.7e-11 Identity = 40/90 (44.44%), Postives = 51/90 (56.67%), Query Frame = 1
BLAST of Cla017398 vs. Swiss-Prot
Match: ARG2_VIGRR (Indole-3-acetic acid-induced protein ARG2 OS=Vigna radiata var. radiata GN=ARG2 PE=2 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 4.3e-09 Identity = 38/97 (39.18%), Postives = 49/97 (50.52%), Query Frame = 1
BLAST of Cla017398 vs. Swiss-Prot
Match: LEA5A_GOSHI (Late embryogenesis abundant protein Lea5-A OS=Gossypium hirsutum GN=LEA5-A PE=2 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.2e-08 Identity = 33/93 (35.48%), Postives = 42/93 (45.16%), Query Frame = 1
BLAST of Cla017398 vs. Swiss-Prot
Match: LEA5D_GOSHI (Late embryogenesis abundant protein Lea5-D OS=Gossypium hirsutum GN=LEA5-D PE=2 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 1.6e-08 Identity = 33/84 (39.29%), Postives = 39/84 (46.43%), Query Frame = 1
BLAST of Cla017398 vs. Swiss-Prot
Match: LEA5_CITSI (Late embryogenesis abundant protein Lea5 OS=Citrus sinensis GN=LEA5 PE=2 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 1.4e-07 Identity = 33/71 (46.48%), Postives = 41/71 (57.75%), Query Frame = 1
BLAST of Cla017398 vs. TrEMBL
Match: A0A0A0KV78_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G001860 PE=4 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 3.4e-21 Identity = 66/112 (58.93%), Postives = 82/112 (73.21%), Query Frame = 1
BLAST of Cla017398 vs. TrEMBL
Match: A0A0A0K996_CUCSA (Protein induced upon tuberization OS=Cucumis sativus GN=Csa_7G398090 PE=4 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 2.6e-13 Identity = 49/95 (51.58%), Postives = 61/95 (64.21%), Query Frame = 1
BLAST of Cla017398 vs. TrEMBL
Match: A0A059AWU9_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_H01103 PE=4 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 2.2e-12 Identity = 48/93 (51.61%), Postives = 58/93 (62.37%), Query Frame = 1
BLAST of Cla017398 vs. TrEMBL
Match: A0A067HGN7_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g034308mg PE=4 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 2.9e-12 Identity = 44/93 (47.31%), Postives = 54/93 (58.06%), Query Frame = 1
BLAST of Cla017398 vs. TrEMBL
Match: A0A059AX49_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_H01104 PE=4 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 4.9e-12 Identity = 48/93 (51.61%), Postives = 58/93 (62.37%), Query Frame = 1
BLAST of Cla017398 vs. NCBI nr
Match: gi|700197661|gb|KGN52819.1| (hypothetical protein Csa_4G001860 [Cucumis sativus]) HSP 1 Score: 109.0 bits (271), Expect = 4.9e-21 Identity = 66/112 (58.93%), Postives = 82/112 (73.21%), Query Frame = 1
BLAST of Cla017398 vs. NCBI nr
Match: gi|659108673|ref|XP_008454328.1| (PREDICTED: late embryogenesis abundant protein Lea5-A-like [Cucumis melo]) HSP 1 Score: 88.6 bits (218), Expect = 6.8e-15 Identity = 51/80 (63.75%), Postives = 60/80 (75.00%), Query Frame = 1
BLAST of Cla017398 vs. NCBI nr
Match: gi|659101343|ref|XP_008451558.1| (PREDICTED: indole-3-acetic acid-induced protein ARG2-like [Cucumis melo]) HSP 1 Score: 83.2 bits (204), Expect = 2.9e-13 Identity = 50/96 (52.08%), Postives = 61/96 (63.54%), Query Frame = 1
BLAST of Cla017398 vs. NCBI nr
Match: gi|449436481|ref|XP_004136021.1| (PREDICTED: indole-3-acetic acid-induced protein ARG2 [Cucumis sativus]) HSP 1 Score: 82.8 bits (203), Expect = 3.7e-13 Identity = 49/95 (51.58%), Postives = 61/95 (64.21%), Query Frame = 1
BLAST of Cla017398 vs. NCBI nr
Match: gi|702435561|ref|XP_010069903.1| (PREDICTED: indole-3-acetic acid-induced protein ARG2-like [Eucalyptus grandis]) HSP 1 Score: 79.7 bits (195), Expect = 3.2e-12 Identity = 48/93 (51.61%), Postives = 58/93 (62.37%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
This gene is associated with the following unigenes:
Analysis Name: InterPro Annotations of watermelon (97103)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |