Cla003063 (gene) Watermelon (97103) v1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.TTATTAGAAAGTCGAATTACTAACTTTTACACGAATTTTCAAGTGGATGAGATCGGTCGAGTGGTCTCAGTTGGAGATGGGATTGCATGTGTTTATGGATTGAAGGAGATTCAAGTTGGGGAAATGGTGGAATTTGCCAGCAGTGTAAAAGGAATAGGCTTAAATCTTGAGAATGAGAATGTAGGGATTGTTGTCTTTGGTAGTGATATCACGGCCAAATCTATCCTGGAAACAAGCTTGGAAGCCAGATAA TTATTAGAAAGTCGAATTACTAACTTTTACACGAATTTTCAAGTGGATGAGATCGGTCGAGTGGTCTCAGTTGGAGATGGGATTGCATGTGTTTATGGATTGAAGGAGATTCAAGTTGGGGAAATGGTGGAATTTGCCAGCAGTGTAAAAGGAATAGGCTTAAATCTTGAGAATGAGAATGTAGGGATTGTTGTCTTTGGTAGTGATATCACGGCCAAATCTATCCTGGAAACAAGCTTGGAAGCCAGATAA TTATTAGAAAGTCGAATTACTAACTTTTACACGAATTTTCAAGTGGATGAGATCGGTCGAGTGGTCTCAGTTGGAGATGGGATTGCATGTGTTTATGGATTGAAGGAGATTCAAGTTGGGGAAATGGTGGAATTTGCCAGCAGTGTAAAAGGAATAGGCTTAAATCTTGAGAATGAGAATGTAGGGATTGTTGTCTTTGGTAGTGATATCACGGCCAAATCTATCCTGGAAACAAGCTTGGAAGCCAGATAA LLESRITNFYTNFQVDEIGRVVSVGDGIACVYGLKEIQVGEMVEFASSVKGIGLNLENENVGIVVFGSDITAKSILETSLEAR
BLAST of Cla003063 vs. Swiss-Prot
Match: ATPAM_BETVU (ATP synthase subunit alpha, mitochondrial OS=Beta vulgaris GN=ATPA PE=3 SV=1) HSP 1 Score: 126.7 bits (317), Expect = 1.2e-28 Identity = 65/73 (89.04%), Postives = 63/73 (86.30%), Query Frame = 1
BLAST of Cla003063 vs. Swiss-Prot
Match: ATPAM_SOYBN (ATP synthase subunit alpha, mitochondrial OS=Glycine max GN=ATPA PE=3 SV=1) HSP 1 Score: 126.7 bits (317), Expect = 1.2e-28 Identity = 65/73 (89.04%), Postives = 63/73 (86.30%), Query Frame = 1
BLAST of Cla003063 vs. Swiss-Prot
Match: ATPAM_OENBI (ATP synthase subunit alpha, mitochondrial OS=Oenothera biennis GN=ATPA PE=3 SV=1) HSP 1 Score: 126.3 bits (316), Expect = 1.5e-28 Identity = 64/73 (87.67%), Postives = 63/73 (86.30%), Query Frame = 1
BLAST of Cla003063 vs. Swiss-Prot
Match: ATPAM_PEA (ATP synthase subunit alpha, mitochondrial OS=Pisum sativum GN=ATPA PE=3 SV=2) HSP 1 Score: 125.9 bits (315), Expect = 2.0e-28 Identity = 64/73 (87.67%), Postives = 64/73 (87.67%), Query Frame = 1
BLAST of Cla003063 vs. Swiss-Prot
Match: ATPAM_ORYSI (ATP synthase subunit alpha, mitochondrial OS=Oryza sativa subsp. indica GN=ATPA PE=3 SV=1) HSP 1 Score: 125.6 bits (314), Expect = 2.6e-28 Identity = 64/73 (87.67%), Postives = 63/73 (86.30%), Query Frame = 1
BLAST of Cla003063 vs. TrEMBL
Match: M8BVG5_AEGTA (ATP synthase subunit alpha OS=Aegilops tauschii GN=F775_13294 PE=3 SV=1) HSP 1 Score: 129.8 bits (325), Expect = 1.5e-27 Identity = 64/73 (87.67%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of Cla003063 vs. TrEMBL
Match: A0A023T2K5_9ROSI (ATP synthase subunit alpha OS=Licania alba GN=atp1 PE=3 SV=1) HSP 1 Score: 128.6 bits (322), Expect = 3.4e-27 Identity = 66/73 (90.41%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of Cla003063 vs. TrEMBL
Match: A0A023T0Z2_9ROSI (ATP synthase subunit alpha OS=Hirtella physophora GN=atp1 PE=3 SV=1) HSP 1 Score: 128.6 bits (322), Expect = 3.4e-27 Identity = 66/73 (90.41%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of Cla003063 vs. TrEMBL
Match: A0A023T0Y9_9ROSI (ATP synthase subunit alpha OS=Hirtella racemosa GN=atp1 PE=3 SV=1) HSP 1 Score: 128.6 bits (322), Expect = 3.4e-27 Identity = 66/73 (90.41%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of Cla003063 vs. TrEMBL
Match: A0A023T1P9_9ROSI (ATP synthase subunit alpha OS=Parinari campestris GN=atp1 PE=3 SV=1) HSP 1 Score: 128.6 bits (322), Expect = 3.4e-27 Identity = 66/73 (90.41%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of Cla003063 vs. NCBI nr
Match: gi|475604639|gb|EMT25798.1| (ATP synthase subunit alpha, mitochondrial [Aegilops tauschii]) HSP 1 Score: 129.8 bits (325), Expect = 2.2e-27 Identity = 64/73 (87.67%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of Cla003063 vs. NCBI nr
Match: gi|295311633|ref|YP_003587244.1| (ATPase subunit 1 [Citrullus lanatus]) HSP 1 Score: 128.6 bits (322), Expect = 4.9e-27 Identity = 66/73 (90.41%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of Cla003063 vs. NCBI nr
Match: gi|618627157|gb|AHX81373.1| (ATP synthase F1 subunit 1 (mitochondrion) [Parinari campestris]) HSP 1 Score: 128.6 bits (322), Expect = 4.9e-27 Identity = 66/73 (90.41%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of Cla003063 vs. NCBI nr
Match: gi|618627159|gb|AHX81374.1| (ATP synthase F1 subunit 1 (mitochondrion) [Couepia guianensis]) HSP 1 Score: 128.6 bits (322), Expect = 4.9e-27 Identity = 66/73 (90.41%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of Cla003063 vs. NCBI nr
Match: gi|618627155|gb|AHX81372.1| (ATP synthase F1 subunit 1 (mitochondrion) [Chrysobalanus icaco]) HSP 1 Score: 128.6 bits (322), Expect = 4.9e-27 Identity = 66/73 (90.41%), Postives = 66/73 (90.41%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of watermelon (97103)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|