Cla002044 (gene) Watermelon (97103) v1
The following sequences are available for this feature:
Legend: polypeptideCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTAATCATTTATAGTATAGGAAACCTTGCTGTGTTCATATTTTCTGAAACATTCATGTTCTTATTTCTTGATTTATCTTAGCATATATTGAACGTGTAATTGGATTAATTTTGGACTTTGTACATGATTGATTTGACCAAAAAAACAAGGAGAGATTGAATGAAAGTTGCACCTTGCTTTGGCTGTTTTAGGCTCTGAGGAGCGTTTTGCCTTTCCCTCTACTGGAGTAATTGAGAGAACACACTAATTTTACCTGAATGTCTTGAAATGTCTTGAAACTTGTTTCTTTTTGTATTTTTGAAGATAATAGGGATTACATGCAACTTTCCAAGTTTAGTTGATTTTTAGTTTTATAATGGTTTGGAATGTTCAAATCCCTGTTTATACCATTGTTAAAATAATAATAATAATTATAAAAAGCTTGAAGCTTGTGAATAATGTAATTTTCTCCTTTATTAGATTCTCCAAATGGATCCAGAGGCTGCACGAACTGCTCGGGAATCACTAGACCTTGCATTTCATATGTCTAACGTACTTGATGCAGGGATCGATCGGCACACTCTCTCTGTCCTCATTGCTCTTTGTGACATGGGTGTGAACCCTGAAGCACTGGCTGCTGTTGTCAAGGAACTACGCTGGGAGCCACCCTCATCAGAGACCGTCGTCTCCGGCAACAAGTCATAA ATGATTCTCCAAATGGATCCAGAGGCTGCACGAACTGCTCGGGAATCACTAGACCTTGCATTTCATATGTCTAACGTACTTGATGCAGGGATCGATCGGCACACTCTCTCTGTCCTCATTGCTCTTTGTGACATGGGTGTGAACCCTGAAGCACTGGCTGCTGTTGTCAAGGAACTACGCTGGGAGCCACCCTCATCAGAGACCGTCGTCTCCGGCAACAAGTCATAA ATGATTCTCCAAATGGATCCAGAGGCTGCACGAACTGCTCGGGAATCACTAGACCTTGCATTTCATATGTCTAACGTACTTGATGCAGGGATCGATCGGCACACTCTCTCTGTCCTCATTGCTCTTTGTGACATGGGTGTGAACCCTGAAGCACTGGCTGCTGTTGTCAAGGAACTACGCTGGGAGCCACCCTCATCAGAGACCGTCGTCTCCGGCAACAAGTCATAA MILQMDPEAARTARESLDLAFHMSNVLDAGIDRHTLSVLIALCDMGVNPEALAAVVKELRWEPPSSETVVSGNKS
BLAST of Cla002044 vs. Swiss-Prot
Match: MZT1B_ARATH (Mitotic-spindle organizing protein 1B OS=Arabidopsis thaliana GN=GIP1 PE=1 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.2e-19 Identity = 50/65 (76.92%), Postives = 53/65 (81.54%), Query Frame = 1
BLAST of Cla002044 vs. Swiss-Prot
Match: MZT1A_ARATH (Mitotic-spindle organizing protein 1A OS=Arabidopsis thaliana GN=GIP2 PE=1 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 4.9e-18 Identity = 44/66 (66.67%), Postives = 53/66 (80.30%), Query Frame = 1
BLAST of Cla002044 vs. Swiss-Prot
Match: MZT1_PICSI (Mitotic-spindle organizing protein 1 OS=Picea sitchensis PE=3 SV=1) HSP 1 Score: 86.7 bits (213), Expect = 1.2e-16 Identity = 44/58 (75.86%), Postives = 47/58 (81.03%), Query Frame = 1
BLAST of Cla002044 vs. Swiss-Prot
Match: MZT1_TAEGU (Mitotic-spindle organizing protein 1 OS=Taeniopygia guttata GN=mzt1 PE=3 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 7.1e-09 Identity = 24/47 (51.06%), Postives = 36/47 (76.60%), Query Frame = 1
BLAST of Cla002044 vs. Swiss-Prot
Match: MZT1_MOUSE (Mitotic-spindle organizing protein 1 OS=Mus musculus GN=Mzt1 PE=1 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 2.7e-08 Identity = 27/59 (45.76%), Postives = 40/59 (67.80%), Query Frame = 1
BLAST of Cla002044 vs. TrEMBL
Match: A0A0A0LMZ6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G094370 PE=4 SV=1) HSP 1 Score: 130.2 bits (326), Expect = 1.1e-27 Identity = 66/71 (92.96%), Postives = 68/71 (95.77%), Query Frame = 1
BLAST of Cla002044 vs. TrEMBL
Match: A0A0D2TES9_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_008G288400 PE=4 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 1.8e-22 Identity = 55/69 (79.71%), Postives = 62/69 (89.86%), Query Frame = 1
BLAST of Cla002044 vs. TrEMBL
Match: C6T5S8_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_03G068900 PE=2 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 3.0e-22 Identity = 55/61 (90.16%), Postives = 58/61 (95.08%), Query Frame = 1
BLAST of Cla002044 vs. TrEMBL
Match: A0A0B2PDD0_GLYSO (Mitotic-spindle organizing protein 1B OS=Glycine soja GN=glysoja_038443 PE=4 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 3.0e-22 Identity = 55/61 (90.16%), Postives = 58/61 (95.08%), Query Frame = 1
BLAST of Cla002044 vs. TrEMBL
Match: I1J6X9_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_01G100100 PE=4 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 3.0e-22 Identity = 55/61 (90.16%), Postives = 58/61 (95.08%), Query Frame = 1
BLAST of Cla002044 vs. NCBI nr
Match: gi|778668078|ref|XP_011649034.1| (PREDICTED: mitotic-spindle organizing protein 1A-like [Cucumis sativus]) HSP 1 Score: 130.2 bits (326), Expect = 1.5e-27 Identity = 66/71 (92.96%), Postives = 68/71 (95.77%), Query Frame = 1
BLAST of Cla002044 vs. NCBI nr
Match: gi|659082266|ref|XP_008441751.1| (PREDICTED: mitotic-spindle organizing protein 1A-like [Cucumis melo]) HSP 1 Score: 127.9 bits (320), Expect = 7.6e-27 Identity = 66/71 (92.96%), Postives = 67/71 (94.37%), Query Frame = 1
BLAST of Cla002044 vs. NCBI nr
Match: gi|823215102|ref|XP_012440309.1| (PREDICTED: mitotic-spindle organizing protein 1B-like [Gossypium raimondii]) HSP 1 Score: 112.8 bits (281), Expect = 2.5e-22 Identity = 55/69 (79.71%), Postives = 62/69 (89.86%), Query Frame = 1
BLAST of Cla002044 vs. NCBI nr
Match: gi|763785935|gb|KJB53006.1| (hypothetical protein B456_008G288400 [Gossypium raimondii]) HSP 1 Score: 112.8 bits (281), Expect = 2.5e-22 Identity = 55/69 (79.71%), Postives = 62/69 (89.86%), Query Frame = 1
BLAST of Cla002044 vs. NCBI nr
Match: gi|356504256|ref|XP_003520913.1| (PREDICTED: mitotic-spindle organizing protein 1B [Glycine max]) HSP 1 Score: 112.1 bits (279), Expect = 4.3e-22 Identity = 55/61 (90.16%), Postives = 58/61 (95.08%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
This gene is associated with the following unigenes:
The following mRNA feature(s) are a part of this gene:
The following transcribed_cluster feature(s) are associated with this gene:
Analysis Name: InterPro Annotations of watermelon (97103)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: None |