Carg11605 (gene) Silver-seed gourd
The following sequences are available for this feature:
Legend: polypeptideCDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGAAAGGGGGAGAAGAAGAACGGAGGAATCGGGAGAACACGAAACCGTACAAAGGGATAAGGATGAGAAAGTGGGGGAAATGGGTCGCCGAAATTCGTGAGCCCAACAAACGCTCCCGAATCTGGCTCGGTTCCTACTCCTCTCCCGTCGCCGCCGCCCGAGCCTACGACACCGCCGTCTTCCACCTCCGTGGCCCCTCTGCCCGTCTCAATTTTCCCGACTTTTTCACCACCGCCGCCGCCGACCGCCCCTTCCCACTCCCTGCCGACATCTCCGCCTCCACCGTCCGCAAGATCGCCGCCGAGGTCGGCGCCCGTGTCGACGCCCTCGAGTCCTCTCTCCGTCACCACTTCCACAACTGTAGAACCGCCGACCAAACTCACCAAACTCCTTCCCCGTCGCCAGCCACGACCACGACAACGACACCCACCAAGCTTCGTTCTGATTCCGGCGGGTTTTCCGATCGGGTTGACCTGAATAAATTGCCCGACCCGGAAGATTCCGACGGCGACTGCGCTAGCACTCCCTGGATAACCTGA ATGAAAGGGGGAGAAGAAGAACGGAGGAATCGGGAGAACACGAAACCGTACAAAGGGATAAGGATGAGAAAGTGGGGGAAATGGGTCGCCGAAATTCGTGAGCCCAACAAACGCTCCCGAATCTGGCTCGGTTCCTACTCCTCTCCCGTCGCCGCCGCCCGAGCCTACGACACCGCCGTCTTCCACCTCCGTGGCCCCTCTGCCCGTCTCAATTTTCCCGACTTTTTCACCACCGCCGCCGCCGACCGCCCCTTCCCACTCCCTGCCGACATCTCCGCCTCCACCGTCCGCAAGATCGCCGCCGAGGTCGGCGCCCGTGTCGACGCCCTCGAGTCCTCTCTCCGTCACCACTTCCACAACTGTAGAACCGCCGACCAAACTCACCAAACTCCTTCCCCGTCGCCAGCCACGACCACGACAACGACACCCACCAAGCTTCGTTCTGATTCCGGCGGGTTTTCCGATCGGGTTGACCTGAATAAATTGCCCGACCCGGAAGATTCCGACGGCGACTGCGCTAGCACTCCCTGGATAACCTGA ATGAAAGGGGGAGAAGAAGAACGGAGGAATCGGGAGAACACGAAACCGTACAAAGGGATAAGGATGAGAAAGTGGGGGAAATGGGTCGCCGAAATTCGTGAGCCCAACAAACGCTCCCGAATCTGGCTCGGTTCCTACTCCTCTCCCGTCGCCGCCGCCCGAGCCTACGACACCGCCGTCTTCCACCTCCGTGGCCCCTCTGCCCGTCTCAATTTTCCCGACTTTTTCACCACCGCCGCCGCCGACCGCCCCTTCCCACTCCCTGCCGACATCTCCGCCTCCACCGTCCGCAAGATCGCCGCCGAGGTCGGCGCCCGTGTCGACGCCCTCGAGTCCTCTCTCCGTCACCACTTCCACAACTGTAGAACCGCCGACCAAACTCACCAAACTCCTTCCCCGTCGCCAGCCACGACCACGACAACGACACCCACCAAGCTTCGTTCTGATTCCGGCGGGTTTTCCGATCGGGTTGACCTGAATAAATTGCCCGACCCGGAAGATTCCGACGGCGACTGCGCTAGCACTCCCTGGATAACCTGA MKGGEEERRNRENTKPYKGIRMRKWGKWVAEIREPNKRSRIWLGSYSSPVAAARAYDTAVFHLRGPSARLNFPDFFTTAAADRPFPLPADISASTVRKIAAEVGARVDALESSLRHHFHNCRTADQTHQTPSPSPATTTTTTPTKLRSDSGGFSDRVDLNKLPDPEDSDGDCASTPWIT
BLAST of Carg11605 vs. NCBI nr
Match: XP_022947660.1 (ethylene-responsive transcription factor ERF011-like [Cucurbita moschata]) HSP 1 Score: 323.2 bits (827), Expect = 5.7e-85 Identity = 177/179 (98.88%), Postives = 177/179 (98.88%), Query Frame = 0
BLAST of Carg11605 vs. NCBI nr
Match: XP_023006973.1 (ethylene-responsive transcription factor ERF011-like [Cucurbita maxima]) HSP 1 Score: 313.2 bits (801), Expect = 5.9e-82 Identity = 160/180 (88.89%), Postives = 160/180 (88.89%), Query Frame = 0
BLAST of Carg11605 vs. NCBI nr
Match: XP_023534076.1 (ethylene-responsive transcription factor ERF011-like [Cucurbita pepo subsp. pepo]) HSP 1 Score: 312.8 bits (800), Expect = 7.7e-82 Identity = 162/180 (90.00%), Postives = 162/180 (90.00%), Query Frame = 0
BLAST of Carg11605 vs. NCBI nr
Match: XP_004149688.1 (PREDICTED: ethylene-responsive transcription factor ERF011-like [Cucumis sativus] >KGN61989.1 hypothetical protein Csa_2G279260 [Cucumis sativus]) HSP 1 Score: 201.1 bits (510), Expect = 3.3e-48 Identity = 111/172 (64.53%), Postives = 124/172 (72.09%), Query Frame = 0
BLAST of Carg11605 vs. NCBI nr
Match: XP_008457742.1 (PREDICTED: ethylene-responsive transcription factor ERF008 [Cucumis melo]) HSP 1 Score: 198.7 bits (504), Expect = 1.6e-47 Identity = 114/179 (63.69%), Postives = 124/179 (69.27%), Query Frame = 0
BLAST of Carg11605 vs. TAIR10
Match: AT2G23340.1 (DREB and EAR motif protein 3) HSP 1 Score: 155.2 bits (391), Expect = 3.7e-38 Identity = 86/161 (53.42%), Postives = 103/161 (63.98%), Query Frame = 0
BLAST of Carg11605 vs. TAIR10
Match: AT5G67190.1 (DREB and EAR motif protein 2) HSP 1 Score: 155.2 bits (391), Expect = 3.7e-38 Identity = 106/173 (61.27%), Postives = 126/173 (72.83%), Query Frame = 0
BLAST of Carg11605 vs. TAIR10
Match: AT3G50260.1 (cooperatively regulated by ethylene and jasmonate 1) HSP 1 Score: 149.4 bits (376), Expect = 2.0e-36 Identity = 82/157 (52.23%), Postives = 102/157 (64.97%), Query Frame = 0
BLAST of Carg11605 vs. TAIR10
Match: AT1G46768.1 (related to AP2 1) HSP 1 Score: 134.4 bits (337), Expect = 6.8e-32 Identity = 69/109 (63.30%), Postives = 81/109 (74.31%), Query Frame = 0
BLAST of Carg11605 vs. TAIR10
Match: AT4G06746.1 (related to AP2 9) HSP 1 Score: 132.1 bits (331), Expect = 3.4e-31 Identity = 74/108 (68.52%), Postives = 82/108 (75.93%), Query Frame = 0
BLAST of Carg11605 vs. Swiss-Prot
Match: sp|O22174|ERF08_ARATH (Ethylene-responsive transcription factor ERF008 OS=Arabidopsis thaliana OX=3702 GN=ERF008 PE=2 SV=1) HSP 1 Score: 155.2 bits (391), Expect = 6.7e-37 Identity = 86/161 (53.42%), Postives = 103/161 (63.98%), Query Frame = 0
BLAST of Carg11605 vs. Swiss-Prot
Match: sp|Q9FH94|ERF10_ARATH (Ethylene-responsive transcription factor ERF010 OS=Arabidopsis thaliana OX=3702 GN=ERF010 PE=2 SV=1) HSP 1 Score: 155.2 bits (391), Expect = 6.7e-37 Identity = 106/173 (61.27%), Postives = 126/173 (72.83%), Query Frame = 0
BLAST of Carg11605 vs. Swiss-Prot
Match: sp|Q9SNE1|ERF11_ARATH (Ethylene-responsive transcription factor ERF011 OS=Arabidopsis thaliana OX=3702 GN=ERF011 PE=2 SV=1) HSP 1 Score: 149.4 bits (376), Expect = 3.7e-35 Identity = 82/157 (52.23%), Postives = 102/157 (64.97%), Query Frame = 0
BLAST of Carg11605 vs. Swiss-Prot
Match: sp|Q8LC30|RAP21_ARATH (Ethylene-responsive transcription factor RAP2-1 OS=Arabidopsis thaliana OX=3702 GN=RAP2-1 PE=2 SV=1) HSP 1 Score: 134.4 bits (337), Expect = 1.2e-30 Identity = 69/109 (63.30%), Postives = 81/109 (74.31%), Query Frame = 0
BLAST of Carg11605 vs. Swiss-Prot
Match: sp|Q8W3M3|RAP29_ARATH (Ethylene-responsive transcription factor RAP2-9 OS=Arabidopsis thaliana OX=3702 GN=RAP2-9 PE=2 SV=1) HSP 1 Score: 132.1 bits (331), Expect = 6.1e-30 Identity = 74/108 (68.52%), Postives = 82/108 (75.93%), Query Frame = 0
BLAST of Carg11605 vs. TrEMBL
Match: tr|A0A0A0LLV5|A0A0A0LLV5_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_2G279260 PE=4 SV=1) HSP 1 Score: 201.1 bits (510), Expect = 2.2e-48 Identity = 111/172 (64.53%), Postives = 124/172 (72.09%), Query Frame = 0
BLAST of Carg11605 vs. TrEMBL
Match: tr|A0A1S3C5T2|A0A1S3C5T2_CUCME (ethylene-responsive transcription factor ERF008 OS=Cucumis melo OX=3656 GN=LOC103497364 PE=4 SV=1) HSP 1 Score: 198.7 bits (504), Expect = 1.1e-47 Identity = 114/179 (63.69%), Postives = 124/179 (69.27%), Query Frame = 0
BLAST of Carg11605 vs. TrEMBL
Match: tr|M5WD73|M5WD73_PRUPE (Uncharacterized protein OS=Prunus persica OX=3760 GN=PRUPE_6G231500 PE=4 SV=1) HSP 1 Score: 176.0 bits (445), Expect = 7.5e-41 Identity = 99/172 (57.56%), Postives = 113/172 (65.70%), Query Frame = 0
BLAST of Carg11605 vs. TrEMBL
Match: tr|V4SQ37|V4SQ37_9ROSI (Uncharacterized protein OS=Citrus clementina OX=85681 GN=CICLE_v10026687mg PE=4 SV=1) HSP 1 Score: 169.5 bits (428), Expect = 7.0e-39 Identity = 99/162 (61.11%), Postives = 109/162 (67.28%), Query Frame = 0
BLAST of Carg11605 vs. TrEMBL
Match: tr|A0A2H5PD53|A0A2H5PD53_CITUN (Uncharacterized protein OS=Citrus unshiu OX=55188 GN=CUMW_125530 PE=4 SV=1) HSP 1 Score: 169.5 bits (428), Expect = 7.0e-39 Identity = 99/162 (61.11%), Postives = 109/162 (67.28%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of silver-seed gourd
Date Performed: 2019-03-07
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|