Carg11106 (gene) Silver-seed gourd
The following sequences are available for this feature:
Legend: polypeptideexonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGACTACCGATGACAACGAGATTGTAAAGTTGGGTTGCCTCTTCAAAGGAGCTATGTTGTGTCTCGTAAAGCCACTCACCATGAAAAACATAAAAGATCTCTGGCAATTTTTATTTATCGGAGGAAGAGAACGATCCATCTCTATTAGAACATCGAATCAAGTTCAAAAGGAATTGACTGATGAAAATGACATAGACAAGAGTACCGACAAGAAATCCCAAAAGACCAAAAGAAAAGAACACGACGAAGAAGTTAGTACTCGACAGGTAGAAGGATATGGTAGTGAATCAACGGGGCCGAAGAAGCCAAAGCTAATTTGGACTCAACAATTGCATAAGACATTCTTGCAAGCCATTGAAGCATTGGGAGTTGATAGTGAGTTTTTTTTTTTTTTTTTTCGTCGTCGTCTTCGTCGTCCTAAAGATCATCTAACTTTGATTTTCTTAACTTAGAAGCTCATCCAAAGGAGATACTTCAACACATGAATGTTCCTGGATTAAGAAAAGAAAACGTTTCAAGTCATTTACAG ATGACTACCGATGACAACGAGATTGTAAAGTTGGGTTGCCTCTTCAAAGGAGCTATGTTGTGTCTCGTAAAGCCACTCACCATGAAAAACATAAAAGATCTCTGGCAATTTTTATTTATCGGAGGAAGAGAACGATCCATCTCTATTAGAACATCGAATCAAGTTCAAAAGGAATTGACTGATGAAAATGACATAGACAAGAGTACCGACAAGAAATCCCAAAAGACCAAAAGAAAAGAACACGACGAAGAAGTTAGTACTCGACAGGTAGAAGGATATGGTAGTGAATCAACGGGGCCGAAGAAGCCAAAGCTAATTTGGACTCAACAATTGCATAAGACATTCTTGCAAGCCATTGAAGCATTGGGAGTTGATAAAGCTCATCCAAAGGAGATACTTCAACACATGAATGTTCCTGGATTAAGAAAAGAAAACGTTTCAAGTCATTTACAG ATGACTACCGATGACAACGAGATTGTAAAGTTGGGTTGCCTCTTCAAAGGAGCTATGTTGTGTCTCGTAAAGCCACTCACCATGAAAAACATAAAAGATCTCTGGCAATTTTTATTTATCGGAGGAAGAGAACGATCCATCTCTATTAGAACATCGAATCAAGTTCAAAAGGAATTGACTGATGAAAATGACATAGACAAGAGTACCGACAAGAAATCCCAAAAGACCAAAAGAAAAGAACACGACGAAGAAGTTAGTACTCGACAGGTAGAAGGATATGGTAGTGAATCAACGGGGCCGAAGAAGCCAAAGCTAATTTGGACTCAACAATTGCATAAGACATTCTTGCAAGCCATTGAAGCATTGGGAGTTGATAAAGCTCATCCAAAGGAGATACTTCAACACATGAATGTTCCTGGATTAAGAAAAGAAAACGTTTCAAGTCATTTACAG MTTDDNEIVKLGCLFKGAMLCLVKPLTMKNIKDLWQFLFIGGRERSISIRTSNQVQKELTDENDIDKSTDKKSQKTKRKEHDEEVSTRQVEGYGSESTGPKKPKLIWTQQLHKTFLQAIEALGVDKAHPKEILQHMNVPGLRKENVSSHLQ
BLAST of Carg11106 vs. NCBI nr
Match: XP_022999829.1 (two-component response regulator ARR2-like [Cucurbita maxima]) HSP 1 Score: 282.7 bits (722), Expect = 7.2e-73 Identity = 141/151 (93.38%), Postives = 148/151 (98.01%), Query Frame = 0
BLAST of Carg11106 vs. NCBI nr
Match: XP_022964475.1 (two-component response regulator ARR2-like isoform X2 [Cucurbita moschata]) HSP 1 Score: 259.6 bits (662), Expect = 6.5e-66 Identity = 132/151 (87.42%), Postives = 137/151 (90.73%), Query Frame = 0
BLAST of Carg11106 vs. NCBI nr
Match: XP_022964474.1 (two-component response regulator ARR2-like isoform X1 [Cucurbita moschata]) HSP 1 Score: 259.6 bits (662), Expect = 6.5e-66 Identity = 132/151 (87.42%), Postives = 137/151 (90.73%), Query Frame = 0
BLAST of Carg11106 vs. NCBI nr
Match: XP_022964477.1 (two-component response regulator ARR2-like isoform X4 [Cucurbita moschata]) HSP 1 Score: 251.5 bits (641), Expect = 1.8e-63 Identity = 130/151 (86.09%), Postives = 135/151 (89.40%), Query Frame = 0
BLAST of Carg11106 vs. NCBI nr
Match: XP_022964476.1 (two-component response regulator ARR2-like isoform X3 [Cucurbita moschata]) HSP 1 Score: 251.5 bits (641), Expect = 1.8e-63 Identity = 130/151 (86.09%), Postives = 135/151 (89.40%), Query Frame = 0
BLAST of Carg11106 vs. TAIR10
Match: AT3G16857.2 (response regulator 1) HSP 1 Score: 71.2 bits (173), Expect = 6.0e-13 Identity = 30/51 (58.82%), Postives = 43/51 (84.31%), Query Frame = 0
BLAST of Carg11106 vs. TAIR10
Match: AT5G58080.1 (response regulator 18) HSP 1 Score: 69.3 bits (168), Expect = 2.3e-12 Identity = 28/51 (54.90%), Postives = 43/51 (84.31%), Query Frame = 0
BLAST of Carg11106 vs. TAIR10
Match: AT4G31920.1 (response regulator 10) HSP 1 Score: 67.8 bits (164), Expect = 6.6e-12 Identity = 30/54 (55.56%), Postives = 41/54 (75.93%), Query Frame = 0
BLAST of Carg11106 vs. TAIR10
Match: AT3G46640.3 (Homeodomain-like superfamily protein) HSP 1 Score: 67.0 bits (162), Expect = 1.1e-11 Identity = 29/51 (56.86%), Postives = 38/51 (74.51%), Query Frame = 0
BLAST of Carg11106 vs. TAIR10
Match: AT3G10760.1 (Homeodomain-like superfamily protein) HSP 1 Score: 66.6 bits (161), Expect = 1.5e-11 Identity = 29/51 (56.86%), Postives = 39/51 (76.47%), Query Frame = 0
BLAST of Carg11106 vs. Swiss-Prot
Match: sp|A2XE31|ORR21_ORYSI (Two-component response regulator ORR21 OS=Oryza sativa subsp. indica OX=39946 GN=RR21 PE=3 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 9.8e-13 Identity = 32/58 (55.17%), Postives = 46/58 (79.31%), Query Frame = 0
BLAST of Carg11106 vs. Swiss-Prot
Match: sp|Q8H7S7|ORR21_ORYSJ (Two-component response regulator ORR21 OS=Oryza sativa subsp. japonica OX=39947 GN=RR21 PE=2 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 9.8e-13 Identity = 32/58 (55.17%), Postives = 46/58 (79.31%), Query Frame = 0
BLAST of Carg11106 vs. Swiss-Prot
Match: sp|B8AEH1|ORR23_ORYSI (Two-component response regulator ORR23 OS=Oryza sativa subsp. indica OX=39946 GN=RR23 PE=3 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 1.7e-12 Identity = 50/152 (32.89%), Postives = 86/152 (56.58%), Query Frame = 0
BLAST of Carg11106 vs. Swiss-Prot
Match: sp|Q6K8X6|ORR23_ORYSJ (Two-component response regulator ORR23 OS=Oryza sativa subsp. japonica OX=39947 GN=RR23 PE=2 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 1.7e-12 Identity = 50/152 (32.89%), Postives = 86/152 (56.58%), Query Frame = 0
BLAST of Carg11106 vs. Swiss-Prot
Match: sp|Q5N6V8|ORR26_ORYSJ (Two-component response regulator ORR26 OS=Oryza sativa subsp. japonica OX=39947 GN=RR26 PE=3 SV=2) HSP 1 Score: 73.2 bits (178), Expect = 2.8e-12 Identity = 47/144 (32.64%), Postives = 81/144 (56.25%), Query Frame = 0
BLAST of Carg11106 vs. TrEMBL
Match: tr|A0A1S3CC31|A0A1S3CC31_CUCME (two-component response regulator ARR10-like OS=Cucumis melo OX=3656 GN=LOC103499089 PE=4 SV=1) HSP 1 Score: 144.4 bits (363), Expect = 2.0e-31 Identity = 80/151 (52.98%), Postives = 97/151 (64.24%), Query Frame = 0
BLAST of Carg11106 vs. TrEMBL
Match: tr|B9RDJ9|B9RDJ9_RICCO (Sensor histidine kinase, putative OS=Ricinus communis OX=3988 GN=RCOM_1613700 PE=4 SV=1) HSP 1 Score: 136.7 bits (343), Expect = 4.2e-29 Identity = 73/157 (46.50%), Postives = 99/157 (63.06%), Query Frame = 0
BLAST of Carg11106 vs. TrEMBL
Match: tr|V4U880|V4U880_9ROSI (Uncharacterized protein OS=Citrus clementina OX=85681 GN=CICLE_v10019943mg PE=4 SV=1) HSP 1 Score: 135.6 bits (340), Expect = 9.4e-29 Identity = 72/151 (47.68%), Postives = 96/151 (63.58%), Query Frame = 0
BLAST of Carg11106 vs. TrEMBL
Match: tr|A0A2H5NPH3|A0A2H5NPH3_CITUN (Uncharacterized protein (Fragment) OS=Citrus unshiu OX=55188 GN=CUMW_064110 PE=4 SV=1) HSP 1 Score: 135.6 bits (340), Expect = 9.4e-29 Identity = 72/151 (47.68%), Postives = 96/151 (63.58%), Query Frame = 0
BLAST of Carg11106 vs. TrEMBL
Match: tr|A0A067HDR9|A0A067HDR9_CITSI (Uncharacterized protein (Fragment) OS=Citrus sinensis OX=2711 GN=CISIN_1g038156mg PE=4 SV=1) HSP 1 Score: 135.6 bits (340), Expect = 9.4e-29 Identity = 72/151 (47.68%), Postives = 96/151 (63.58%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of silver-seed gourd
Date Performed: 2019-03-07
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|