Carg00280 (gene) Silver-seed gourd
The following sequences are available for this feature:
Legend: polypeptideexonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCGAACTGCTTGATGCTACTTTCTCGTAGCAGCGCGTCCACTACTACAGATTTCGAATCGTCTTTGTCGTCTTCACCGAATCGTGTTTTCGAGTGCAAGACGTGCAATCGGCAGTTTCCGTCGTTTCAGGCCCTAGGCGGCCACCGCGCCAGTCACAAGAAGCCGCGAATTGTAGGACCAGACGGCGGAAACTCCGATGGATCTTCATCGCAAGGATCTCCAACCAAGCCGAAGACGCATGAGTGCAGTATCTGTGGATTGGAATTCGCGATTGGTCAAGCGCTTGGTGGACATATGAGGAGACATAGAGCTACGACGCTGTTGACCGATCACGCTCGACTTACAAATCATCCGAGTAGTTTATCTCAGCCGCCGCGTTCTCAACCGCCTGTGGTGAAGAAGACGAACGGCGGTGGAAGGATTCTATGCTTGGATCTGAATTTGACTCCGTCCGAGAACGATAAACAGTTTCTTCAGCTTGGAAAGAGTATTTCCATGGTTGATTGTTTCTTCTGA ATGGCGAACTGCTTGATGCTACTTTCTCGTAGCAGCGCGTCCACTACTACAGATTTCGAATCGTCTTTGTCGTCTTCACCGAATCGTGTTTTCGAGTGCAAGACGTGCAATCGGCAGTTTCCGTCGTTTCAGGCCCTAGGCGGCCACCGCGCCAGTCACAAGAAGCCGCGAATTGTAGGACCAGACGGCGGAAACTCCGATGGATCTTCATCGCAAGGATCTCCAACCAAGCCGAAGACGCATGAGTGCAGTATCTGTGGATTGGAATTCGCGATTGGTCAAGCGCTTGGTGGACATATGAGGAGACATAGAGCTACGACGCTGTTGACCGATCACGCTCGACTTACAAATCATCCGAGTAGTTTATCTCAGCCGCCGCGTTCTCAACCGCCTGTGGTGAAGAAGACGAACGGCGGTGGAAGGATTCTATGCTTGGATCTGAATTTGACTCCGTCCGAGAACGATAAACAGTTTCTTCAGCTTGGAAAGAGTATTTCCATGGTTGATTGTTTCTTCTGA ATGGCGAACTGCTTGATGCTACTTTCTCGTAGCAGCGCGTCCACTACTACAGATTTCGAATCGTCTTTGTCGTCTTCACCGAATCGTGTTTTCGAGTGCAAGACGTGCAATCGGCAGTTTCCGTCGTTTCAGGCCCTAGGCGGCCACCGCGCCAGTCACAAGAAGCCGCGAATTGTAGGACCAGACGGCGGAAACTCCGATGGATCTTCATCGCAAGGATCTCCAACCAAGCCGAAGACGCATGAGTGCAGTATCTGTGGATTGGAATTCGCGATTGGTCAAGCGCTTGGTGGACATATGAGGAGACATAGAGCTACGACGCTGTTGACCGATCACGCTCGACTTACAAATCATCCGAGTAGTTTATCTCAGCCGCCGCGTTCTCAACCGCCTGTGGTGAAGAAGACGAACGGCGGTGGAAGGATTCTATGCTTGGATCTGAATTTGACTCCGTCCGAGAACGATAAACAGTTTCTTCAGCTTGGAAAGAGTATTTCCATGGTTGATTGTTTCTTCTGA MANCLMLLSRSSASTTTDFESSLSSSPNRVFECKTCNRQFPSFQALGGHRASHKKPRIVGPDGGNSDGSSSQGSPTKPKTHECSICGLEFAIGQALGGHMRRHRATTLLTDHARLTNHPSSLSQPPRSQPPVVKKTNGGGRILCLDLNLTPSENDKQFLQLGKSISMVDCFF
BLAST of Carg00280 vs. NCBI nr
Match: XP_023545353.1 (zinc finger protein ZAT12-like [Cucurbita pepo subsp. pepo]) HSP 1 Score: 253.1 bits (645), Expect = 7.0e-64 Identity = 169/172 (98.26%), Postives = 169/172 (98.26%), Query Frame = 0
BLAST of Carg00280 vs. NCBI nr
Match: XP_022995602.1 (zinc finger protein ZAT12-like [Cucurbita maxima]) HSP 1 Score: 251.5 bits (641), Expect = 2.0e-63 Identity = 168/172 (97.67%), Postives = 168/172 (97.67%), Query Frame = 0
BLAST of Carg00280 vs. NCBI nr
Match: XP_022957121.1 (zinc finger protein ZAT12-like [Cucurbita moschata]) HSP 1 Score: 237.7 bits (605), Expect = 3.0e-59 Identity = 162/172 (94.19%), Postives = 162/172 (94.19%), Query Frame = 0
BLAST of Carg00280 vs. NCBI nr
Match: XP_008461644.1 (PREDICTED: zinc finger protein ZAT12-like [Cucumis melo]) HSP 1 Score: 151.0 bits (380), Expect = 3.7e-33 Identity = 123/172 (71.51%), Postives = 130/172 (75.58%), Query Frame = 0
BLAST of Carg00280 vs. NCBI nr
Match: XP_022985423.1 (zinc finger protein ZAT12-like [Cucurbita maxima]) HSP 1 Score: 150.6 bits (379), Expect = 4.9e-33 Identity = 126/175 (72.00%), Postives = 130/175 (74.29%), Query Frame = 0
BLAST of Carg00280 vs. TAIR10
Match: AT2G37430.1 (C2H2 and C2HC zinc fingers superfamily protein) HSP 1 Score: 75.9 bits (185), Expect = 2.8e-14 Identity = 74/159 (46.54%), Postives = 93/159 (58.49%), Query Frame = 0
BLAST of Carg00280 vs. TAIR10
Match: AT2G28710.1 (C2H2-type zinc finger family protein) HSP 1 Score: 75.5 bits (184), Expect = 3.6e-14 Identity = 90/168 (53.57%), Postives = 108/168 (64.29%), Query Frame = 0
BLAST of Carg00280 vs. TAIR10
Match: AT3G53600.1 (C2H2-type zinc finger family protein) HSP 1 Score: 65.9 bits (159), Expect = 2.9e-11 Identity = 34/57 (59.65%), Postives = 41/57 (71.93%), Query Frame = 0
BLAST of Carg00280 vs. TAIR10
Match: AT5G59820.1 (C2H2-type zinc finger family protein) HSP 1 Score: 65.9 bits (159), Expect = 2.9e-11 Identity = 78/164 (47.56%), Postives = 92/164 (56.10%), Query Frame = 0
BLAST of Carg00280 vs. TAIR10
Match: AT2G28200.1 (C2H2-type zinc finger family protein) HSP 1 Score: 63.2 bits (152), Expect = 1.9e-10 Identity = 36/65 (55.38%), Postives = 44/65 (67.69%), Query Frame = 0
BLAST of Carg00280 vs. Swiss-Prot
Match: sp|Q9SLD4|ZAT11_ARATH (Zinc finger protein ZAT11 OS=Arabidopsis thaliana OX=3702 GN=ZAT11 PE=2 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 5.0e-13 Identity = 74/159 (46.54%), Postives = 93/159 (58.49%), Query Frame = 0
BLAST of Carg00280 vs. Swiss-Prot
Match: sp|Q42410|ZAT12_ARATH (Zinc finger protein ZAT12 OS=Arabidopsis thaliana OX=3702 GN=ZAT12 PE=2 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 5.2e-10 Identity = 78/164 (47.56%), Postives = 92/164 (56.10%), Query Frame = 0
BLAST of Carg00280 vs. Swiss-Prot
Match: sp|Q681X4|ZAT5_ARATH (Zinc finger protein ZAT5 OS=Arabidopsis thaliana OX=3702 GN=ZAT5 PE=2 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 3.3e-09 Identity = 36/65 (55.38%), Postives = 44/65 (67.69%), Query Frame = 0
BLAST of Carg00280 vs. Swiss-Prot
Match: sp|Q42453|ZAT7_ARATH (Zinc finger protein ZAT7 OS=Arabidopsis thaliana OX=3702 GN=ZAT7 PE=2 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 1.2e-06 Identity = 70/172 (40.70%), Postives = 84/172 (48.84%), Query Frame = 0
BLAST of Carg00280 vs. Swiss-Prot
Match: sp|Q9LX85|ZAT8_ARATH (Zinc finger protein ZAT8 OS=Arabidopsis thaliana OX=3702 GN=ZAT8 PE=2 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 2.0e-06 Identity = 30/54 (55.56%), Postives = 32/54 (59.26%), Query Frame = 0
BLAST of Carg00280 vs. TrEMBL
Match: tr|A0A1S3CF73|A0A1S3CF73_CUCME (zinc finger protein ZAT12-like OS=Cucumis melo OX=3656 GN=LOC103500198 PE=4 SV=1) HSP 1 Score: 151.0 bits (380), Expect = 2.5e-33 Identity = 123/172 (71.51%), Postives = 130/172 (75.58%), Query Frame = 0
BLAST of Carg00280 vs. TrEMBL
Match: tr|A0A0A0KLU2|A0A0A0KLU2_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_5G180920 PE=4 SV=1) HSP 1 Score: 147.1 bits (370), Expect = 3.6e-32 Identity = 124/172 (72.09%), Postives = 128/172 (74.42%), Query Frame = 0
BLAST of Carg00280 vs. TrEMBL
Match: tr|W9RAF7|W9RAF7_9ROSA (Zinc finger protein ZAT11 OS=Morus notabilis OX=981085 GN=L484_025373 PE=4 SV=1) HSP 1 Score: 124.8 bits (312), Expect = 1.9e-25 Identity = 109/174 (62.64%), Postives = 125/174 (71.84%), Query Frame = 0
BLAST of Carg00280 vs. TrEMBL
Match: tr|B9SR50|B9SR50_RICCO (Nucleic acid binding protein, putative OS=Ricinus communis OX=3988 GN=RCOM_0466460 PE=4 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 5.2e-23 Identity = 105/188 (55.85%), Postives = 120/188 (63.83%), Query Frame = 0
BLAST of Carg00280 vs. TrEMBL
Match: tr|A0A1B1LZW1|A0A1B1LZW1_BETPL (ZFP2 OS=Betula platyphylla OX=78630 PE=2 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 2.0e-22 Identity = 80/175 (45.71%), Postives = 90/175 (51.43%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of silver-seed gourd
Date Performed: 2019-03-07
The following gene(s) are orthologous to this gene: The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|