|
The following sequences are available for this feature:
Gene sequence (with intron) Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below. TGCACAATAGCATCCGTCGTAGCCGACGCTATTGTGCAC mRNA sequence TGCACAATAGCATCCGTCGTAGCCGACGCTATTGTGCAC Coding sequence (CDS) TGCACAATAGCATCCGTCGTAGCCGACGCTATTGTGCAC
The following BLAST results are available for this feature:
Match Name | E-value | Identity | Description | |
Match Name | E-value | Identity | Description | |
Match Name | E-value | Identity | Description | |
Match Name | E-value | Identity | Description | |
GO Assignments
This gene is annotated with the following GO terms.
Category |
Term Accession |
Term Name |
biological_process |
GO:0008150 |
biological_process |
cellular_component |
GO:0005575 |
cellular_component |
molecular_function |
GO:0003674 |
molecular_function |
The following mRNA feature(s) are a part of this gene:
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|