CSPI07G15710 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTGAAGGTGAATCCAATATGGGAACTGCACACAGAAGGTGTTCAATAGATTGCTTCAAAGAGATGTGTTTGTGTGGAATGTGGTTGTACAGGGGTATGCAAATTTGGGTCCGTTTGTTGAAGCTCTTAACCTATTTGATCATGAAATGCGAGTCAGTGGGGCACCCACAAATCGCTATACATTTCCTTTTGTGATGAAGGCATGTGGTGCAAAGAAGAACAGTGACAAGGGTGAGATTGTTCATGGACATGTTTTGAAATGTGCGTTGGACTTGGATTTATCTGTGGGTAATGATCTGATCACGTTTTATTCCAAATGTACTCACAGGAAGTTCAAACTGCTAGTAAAGTGTTTGATGATATGCCTCTGATATACGTTGTGAGTTAG ATGGTGAAGGGGTATGCAAATTTGGGTCCGTTTGTTGAAGCTCTTAACCTATTTGATCATGAAATGCGAGTCAGTGGGGCACCCACAAATCGCTATACATTTCCTTTTGTGATGAAGGCATGTGGTGCAAAGAAGAACAGTGACAAGGGTGAGATTGTTCATGGACATGTTTTGAAATGTGCGTTGGACTTGGATTTATCTGAAGTTCAAACTGCTAGTAAAGTGTTTGATGATATGCCTCTGATATACGTTGTGAGTTAG ATGGTGAAGGGGTATGCAAATTTGGGTCCGTTTGTTGAAGCTCTTAACCTATTTGATCATGAAATGCGAGTCAGTGGGGCACCCACAAATCGCTATACATTTCCTTTTGTGATGAAGGCATGTGGTGCAAAGAAGAACAGTGACAAGGGTGAGATTGTTCATGGACATGTTTTGAAATGTGCGTTGGACTTGGATTTATCTGAAGTTCAAACTGCTAGTAAAGTGTTTGATGATATGCCTCTGATATACGTTGTGAGTTAG
BLAST of CSPI07G15710 vs. Swiss-Prot
Match: PPR21_ARATH (Pentatricopeptide repeat-containing protein At1g08070, chloroplastic OS=Arabidopsis thaliana GN=PCMP-H12 PE=2 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 6.3e-09 Identity = 38/99 (38.38%), Postives = 50/99 (50.51%), Query Frame = 1
BLAST of CSPI07G15710 vs. Swiss-Prot
Match: PPR45_ARATH (Pentatricopeptide repeat-containing protein At1g15510, chloroplastic OS=Arabidopsis thaliana GN=PCMP-H73 PE=3 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 2.4e-08 Identity = 32/99 (32.32%), Postives = 52/99 (52.53%), Query Frame = 1
BLAST of CSPI07G15710 vs. Swiss-Prot
Match: PP237_ARATH (Pentatricopeptide repeat-containing protein At3g16610 OS=Arabidopsis thaliana GN=PCMP-E91 PE=2 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 5.4e-08 Identity = 32/93 (34.41%), Postives = 51/93 (54.84%), Query Frame = 1
BLAST of CSPI07G15710 vs. Swiss-Prot
Match: PPR68_ARATH (Pentatricopeptide repeat-containing protein At1g31920 OS=Arabidopsis thaliana GN=PCMP-H11 PE=2 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 1.7e-06 Identity = 25/66 (37.88%), Postives = 40/66 (60.61%), Query Frame = 1
BLAST of CSPI07G15710 vs. TrEMBL
Match: A0A0A0K4V2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G378390 PE=4 SV=1) HSP 1 Score: 176.4 bits (446), Expect = 1.5e-41 Identity = 82/85 (96.47%), Postives = 84/85 (98.82%), Query Frame = 1
BLAST of CSPI07G15710 vs. TrEMBL
Match: A0A0A0L101_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G002500 PE=4 SV=1) HSP 1 Score: 135.6 bits (340), Expect = 2.9e-29 Identity = 68/99 (68.69%), Postives = 77/99 (77.78%), Query Frame = 1
BLAST of CSPI07G15710 vs. TrEMBL
Match: G7LAB1_MEDTR (PPR containing plant-like protein OS=Medicago truncatula GN=MTR_8g074780 PE=4 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 2.3e-18 Identity = 45/92 (48.91%), Postives = 66/92 (71.74%), Query Frame = 1
BLAST of CSPI07G15710 vs. TrEMBL
Match: D7T1S2_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_00s0264g00110 PE=4 SV=1) HSP 1 Score: 98.6 bits (244), Expect = 4.0e-18 Identity = 46/90 (51.11%), Postives = 63/90 (70.00%), Query Frame = 1
BLAST of CSPI07G15710 vs. TrEMBL
Match: M5WJX7_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa021315mg PE=4 SV=1) HSP 1 Score: 97.8 bits (242), Expect = 6.8e-18 Identity = 44/93 (47.31%), Postives = 64/93 (68.82%), Query Frame = 1
BLAST of CSPI07G15710 vs. TAIR10
Match: AT1G08070.1 (AT1G08070.1 Tetratricopeptide repeat (TPR)-like superfamily protein) HSP 1 Score: 61.2 bits (147), Expect = 3.6e-10 Identity = 38/99 (38.38%), Postives = 50/99 (50.51%), Query Frame = 1
BLAST of CSPI07G15710 vs. TAIR10
Match: AT1G15510.1 (AT1G15510.1 Tetratricopeptide repeat (TPR)-like superfamily protein) HSP 1 Score: 59.3 bits (142), Expect = 1.4e-09 Identity = 32/99 (32.32%), Postives = 52/99 (52.53%), Query Frame = 1
BLAST of CSPI07G15710 vs. TAIR10
Match: AT3G16610.1 (AT3G16610.1 pentatricopeptide (PPR) repeat-containing protein) HSP 1 Score: 58.2 bits (139), Expect = 3.0e-09 Identity = 32/93 (34.41%), Postives = 51/93 (54.84%), Query Frame = 1
BLAST of CSPI07G15710 vs. TAIR10
Match: AT3G61170.1 (AT3G61170.1 Tetratricopeptide repeat (TPR)-like superfamily protein) HSP 1 Score: 54.3 bits (129), Expect = 4.4e-08 Identity = 27/69 (39.13%), Postives = 38/69 (55.07%), Query Frame = 1
BLAST of CSPI07G15710 vs. TAIR10
Match: AT1G31920.1 (AT1G31920.1 Tetratricopeptide repeat (TPR)-like superfamily protein) HSP 1 Score: 53.1 bits (126), Expect = 9.7e-08 Identity = 25/66 (37.88%), Postives = 40/66 (60.61%), Query Frame = 1
BLAST of CSPI07G15710 vs. NCBI nr
Match: gi|700189517|gb|KGN44750.1| (hypothetical protein Csa_7G378390 [Cucumis sativus]) HSP 1 Score: 176.4 bits (446), Expect = 2.2e-41 Identity = 82/85 (96.47%), Postives = 84/85 (98.82%), Query Frame = 1
BLAST of CSPI07G15710 vs. NCBI nr
Match: gi|778674677|ref|XP_011650274.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g46790, chloroplastic-like [Cucumis sativus]) HSP 1 Score: 135.6 bits (340), Expect = 4.2e-29 Identity = 68/99 (68.69%), Postives = 77/99 (77.78%), Query Frame = 1
BLAST of CSPI07G15710 vs. NCBI nr
Match: gi|659096558|ref|XP_008449159.1| (PREDICTED: pentatricopeptide repeat-containing protein At2g29760, chloroplastic-like [Cucumis melo]) HSP 1 Score: 130.2 bits (326), Expect = 1.8e-27 Identity = 66/99 (66.67%), Postives = 75/99 (75.76%), Query Frame = 1
BLAST of CSPI07G15710 vs. NCBI nr
Match: gi|657960758|ref|XP_008371959.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g46790, chloroplastic-like [Malus domestica]) HSP 1 Score: 108.6 bits (270), Expect = 5.5e-21 Identity = 48/93 (51.61%), Postives = 67/93 (72.04%), Query Frame = 1
BLAST of CSPI07G15710 vs. NCBI nr
Match: gi|502153624|ref|XP_004509407.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g46790, chloroplastic-like [Cicer arietinum]) HSP 1 Score: 107.1 bits (266), Expect = 1.6e-20 Identity = 51/99 (51.52%), Postives = 68/99 (68.69%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|