CSPI07G08620 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGTACGGTTCTGTAATAGCGATGAGAACAGTGATGTTATTACCGACTATGATTATCTAACAGTTCGAGTACCGTTGATATAGTTGAGGCTCAATCAAAATATGGTTTTTGGGGTTGGAATTTGTGGCGTCAACCTATAGGGTTTGTTATTTTTCTAATTTCTTCCTTAGCAGAATGCGAGAGATTACCTTTTGATTTACCAGAAGCAGAAGAAGAATTAGTAGCGGGTTATCAAACTGAGTATTCGGGTATAAAATTTGGTTTATTTTATGTTGCTTCCTATCTAAATCTATTAGTTTCTTCGTTATTTGTAACTGTTCTTTACTTGGGTGGTTGGGATATCTCTATTCCATACATATTAGGTTATGAACTTTTTGAAATAAATAAAGTGTATGAAGTCTTTGGAATGACAATTAGTATCTTTATTACATTAGCGAAAACTTATTTGTTCTTGTTCATTTCTATAGCAACAAGATGGACTTTACCCCGACTAAGAATAGATCAACTCGGCAATTCATGGAAAGATGAATCGAGGAAAAACTTATGA ATGTACGGTTCTGTAATAGCGATGAGAACAGTGATTTCGAGTACCGTTGATATAGTTGAGGCTCAATCAAAATATGAATGCGAGAGATTACCTTTTGATTTACCAGAAGCAGAAGAAGAATTAGTAGCGGGTTATCAAACTGAGTATTCGGCAACAAGATGGACTTTACCCCGACTAAGAATAGATCAACTCGGCAATTCATGGAAAGATGAATCGAGGAAAAACTTATGA ATGTACGGTTCTGTAATAGCGATGAGAACAGTGATTTCGAGTACCGTTGATATAGTTGAGGCTCAATCAAAATATGAATGCGAGAGATTACCTTTTGATTTACCAGAAGCAGAAGAAGAATTAGTAGCGGGTTATCAAACTGAGTATTCGGCAACAAGATGGACTTTACCCCGACTAAGAATAGATCAACTCGGCAATTCATGGAAAGATGAATCGAGGAAAAACTTATGA
BLAST of CSPI07G08620 vs. Swiss-Prot
Match: NU1C_SORBI (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Sorghum bicolor GN=ndhA PE=3 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 4.6e-11 Identity = 40/74 (54.05%), Postives = 45/74 (60.81%), Query Frame = 1
BLAST of CSPI07G08620 vs. Swiss-Prot
Match: NU1C_AGRST (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Agrostis stolonifera GN=ndhA PE=3 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 4.6e-11 Identity = 40/74 (54.05%), Postives = 45/74 (60.81%), Query Frame = 1
BLAST of CSPI07G08620 vs. Swiss-Prot
Match: NU1C_CALFG (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Calycanthus floridus var. glaucus GN=ndhA PE=3 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 6.0e-11 Identity = 40/74 (54.05%), Postives = 45/74 (60.81%), Query Frame = 1
BLAST of CSPI07G08620 vs. Swiss-Prot
Match: NU1C_POPAL (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Populus alba GN=ndhA PE=3 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 6.0e-11 Identity = 40/74 (54.05%), Postives = 45/74 (60.81%), Query Frame = 1
BLAST of CSPI07G08620 vs. Swiss-Prot
Match: NU1C_LACSA (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Lactuca sativa GN=ndhA PE=3 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 6.0e-11 Identity = 40/74 (54.05%), Postives = 45/74 (60.81%), Query Frame = 1
BLAST of CSPI07G08620 vs. TrEMBL
Match: A0A124SAL1_CYNCS (NADH:ubiquinone oxidoreductase, subunit 1/F420H2 oxidoreductase subunit H (Fragment) OS=Cynara cardunculus var. scolymus GN=Ccrd_024865 PE=3 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 2.9e-12 Identity = 45/79 (56.96%), Postives = 49/79 (62.03%), Query Frame = 1
BLAST of CSPI07G08620 vs. TrEMBL
Match: A0A096XAW4_9ROSI (NADH-quinone oxidoreductase subunit H OS=Erodium manescavi GN=ndhA PE=3 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.3e-09 Identity = 42/76 (55.26%), Postives = 47/76 (61.84%), Query Frame = 1
BLAST of CSPI07G08620 vs. TrEMBL
Match: A0A096XAN7_9ROSI (NADH-quinone oxidoreductase subunit H OS=Erodium rupestre GN=ndhA PE=3 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.3e-09 Identity = 42/76 (55.26%), Postives = 47/76 (61.84%), Query Frame = 1
BLAST of CSPI07G08620 vs. TrEMBL
Match: A0A096XCS1_9ROSI (NADH-quinone oxidoreductase subunit H OS=Erodium foetidum subsp. foetidum GN=ndhA PE=3 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.3e-09 Identity = 42/76 (55.26%), Postives = 47/76 (61.84%), Query Frame = 1
BLAST of CSPI07G08620 vs. TrEMBL
Match: A0A0H3W322_FRAVE (NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic OS=Fragaria vesca subsp. bracteata GN=ndhA PE=3 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.8e-09 Identity = 40/74 (54.05%), Postives = 45/74 (60.81%), Query Frame = 1
BLAST of CSPI07G08620 vs. TAIR10
Match: ATCG01100.1 (ATCG01100.1 NADH dehydrogenase family protein) HSP 1 Score: 65.9 bits (159), Expect = 1.3e-11 Identity = 37/66 (56.06%), Postives = 40/66 (60.61%), Query Frame = 1
BLAST of CSPI07G08620 vs. NCBI nr
Match: gi|976899192|gb|KVH87822.1| (NADH:ubiquinone oxidoreductase, subunit 1/F420H2 oxidoreductase subunit H, partial [Cynara cardunculus var. scolymus]) HSP 1 Score: 79.0 bits (193), Expect = 4.1e-12 Identity = 45/79 (56.96%), Postives = 49/79 (62.03%), Query Frame = 1
BLAST of CSPI07G08620 vs. NCBI nr
Match: gi|571031480|gb|AHF21124.1| (NADH-plastoquinone oxidoreductase subunit 1 [Erodium rupestre]) HSP 1 Score: 70.1 bits (170), Expect = 1.9e-09 Identity = 42/76 (55.26%), Postives = 47/76 (61.84%), Query Frame = 1
BLAST of CSPI07G08620 vs. NCBI nr
Match: gi|571031556|gb|AHF21199.1| (NADH-plastoquinone oxidoreductase subunit 1 [Erodium manescavi]) HSP 1 Score: 70.1 bits (170), Expect = 1.9e-09 Identity = 42/76 (55.26%), Postives = 47/76 (61.84%), Query Frame = 1
BLAST of CSPI07G08620 vs. NCBI nr
Match: gi|574450476|gb|AHG24660.1| (NADH-plastoquinone oxidoreductase subunit 1 [Erodium foetidum subsp. foetidum]) HSP 1 Score: 70.1 bits (170), Expect = 1.9e-09 Identity = 42/76 (55.26%), Postives = 47/76 (61.84%), Query Frame = 1
BLAST of CSPI07G08620 vs. NCBI nr
Match: gi|823334190|gb|AKI31042.1| (NADH dehydrogenase subunit 1 (chloroplast) [Fragaria vesca subsp. bracteata]) HSP 1 Score: 69.7 bits (169), Expect = 2.5e-09 Identity = 40/74 (54.05%), Postives = 45/74 (60.81%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|