CSPI06G26330 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTTCTGATCCAGCGCCTGGTGCCGGCGGCTATACTCCAGTTAAGGATCCTCAAAGCTTACGAATGCAAGAATTAGCTGAATGGGCAGTAGAAGAGTACAACAAAAAAGAAGGGACACACTTGAGGTTTGTTTGTATATTGGTGTGTGAGTCGCAGATTGTGGAAGGAGTCAACTACCGCTTTATCTTGAGGGCTAAGGATGAAAACGATAATGAAGGAAACTATGAGGCTATTGTCTGGGAGAAAACATGGGAGCATTTCAAGGGGCTGGTTTACTTTAAGCAACTCTTATTGACTGAATCATGA ATGGCTTCTGATCCAGCGCCTGGTGCCGGCGGCTATACTCCAGTTAAGGATCCTCAAAGCTTACGAATGCAAGAATTAGCTGAATGGGCAGTAGAAGAGTACAACAAAAAAGAAGGGACACACTTGAGGTTTGTTTGTATATTGGTGTGTGAGTCGCAGATTGTGGAAGGAGTCAACTACCGCTTTATCTTGAGGGCTAAGGATGAAAACGATAATGAAGGAAACTATGAGGCTATTGTCTGGGAGAAAACATGGGAGCATTTCAAGGGGCTGGTTTACTTTAAGCAACTCTTATTGACTGAATCATGA ATGGCTTCTGATCCAGCGCCTGGTGCCGGCGGCTATACTCCAGTTAAGGATCCTCAAAGCTTACGAATGCAAGAATTAGCTGAATGGGCAGTAGAAGAGTACAACAAAAAAGAAGGGACACACTTGAGGTTTGTTTGTATATTGGTGTGTGAGTCGCAGATTGTGGAAGGAGTCAACTACCGCTTTATCTTGAGGGCTAAGGATGAAAACGATAATGAAGGAAACTATGAGGCTATTGTCTGGGAGAAAACATGGGAGCATTTCAAGGGGCTGGTTTACTTTAAGCAACTCTTATTGACTGAATCATGA
BLAST of CSPI06G26330 vs. Swiss-Prot
Match: CYT1_ACTDE (Cysteine proteinase inhibitor 1 OS=Actinidia deliciosa PE=1 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 9.1e-15 Identity = 35/89 (39.33%), Postives = 59/89 (66.29%), Query Frame = 1
BLAST of CSPI06G26330 vs. Swiss-Prot
Match: CYTM_SOLTU (Multicystatin OS=Solanum tuberosum PE=1 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 1.3e-13 Identity = 37/95 (38.95%), Postives = 55/95 (57.89%), Query Frame = 1
BLAST of CSPI06G26330 vs. Swiss-Prot
Match: CYT5_ARATH (Cysteine proteinase inhibitor 5 OS=Arabidopsis thaliana GN=CYS5 PE=2 SV=2) HSP 1 Score: 73.6 bits (179), Expect = 1.5e-12 Identity = 34/90 (37.78%), Postives = 54/90 (60.00%), Query Frame = 1
BLAST of CSPI06G26330 vs. Swiss-Prot
Match: CYT4_ARATH (Cysteine proteinase inhibitor 4 OS=Arabidopsis thaliana GN=CYS4 PE=3 SV=2) HSP 1 Score: 64.3 bits (155), Expect = 8.9e-10 Identity = 34/90 (37.78%), Postives = 49/90 (54.44%), Query Frame = 1
BLAST of CSPI06G26330 vs. Swiss-Prot
Match: CYTI_VIGUN (Cysteine proteinase inhibitor OS=Vigna unguiculata PE=1 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.2e-09 Identity = 38/89 (42.70%), Postives = 49/89 (55.06%), Query Frame = 1
BLAST of CSPI06G26330 vs. TrEMBL
Match: A0A0A0KIY5_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus GN=Csa_6G483248 PE=3 SV=1) HSP 1 Score: 213.4 bits (542), Expect = 1.3e-52 Identity = 100/102 (98.04%), Postives = 101/102 (99.02%), Query Frame = 1
BLAST of CSPI06G26330 vs. TrEMBL
Match: A0A0A0KF46_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus GN=Csa_6G483245 PE=3 SV=1) HSP 1 Score: 142.5 bits (358), Expect = 2.8e-31 Identity = 71/94 (75.53%), Postives = 78/94 (82.98%), Query Frame = 1
BLAST of CSPI06G26330 vs. TrEMBL
Match: A0A0A0KF22_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus GN=Csa_6G473520 PE=3 SV=1) HSP 1 Score: 135.6 bits (340), Expect = 3.5e-29 Identity = 69/103 (66.99%), Postives = 81/103 (78.64%), Query Frame = 1
BLAST of CSPI06G26330 vs. TrEMBL
Match: A0A0A0KKR3_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus GN=Csa_6G483247 PE=3 SV=1) HSP 1 Score: 127.9 bits (320), Expect = 7.3e-27 Identity = 63/101 (62.38%), Postives = 74/101 (73.27%), Query Frame = 1
BLAST of CSPI06G26330 vs. TrEMBL
Match: O80389_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus PE=2 SV=1) HSP 1 Score: 122.1 bits (305), Expect = 4.0e-25 Identity = 52/89 (58.43%), Postives = 66/89 (74.16%), Query Frame = 1
BLAST of CSPI06G26330 vs. TAIR10
Match: AT5G47550.1 (AT5G47550.1 Cystatin/monellin superfamily protein) HSP 1 Score: 73.6 bits (179), Expect = 8.2e-14 Identity = 34/90 (37.78%), Postives = 54/90 (60.00%), Query Frame = 1
BLAST of CSPI06G26330 vs. TAIR10
Match: AT4G16500.1 (AT4G16500.1 Cystatin/monellin superfamily protein) HSP 1 Score: 64.3 bits (155), Expect = 5.0e-11 Identity = 34/90 (37.78%), Postives = 49/90 (54.44%), Query Frame = 1
BLAST of CSPI06G26330 vs. TAIR10
Match: AT3G12490.2 (AT3G12490.2 cystatin B) HSP 1 Score: 51.6 bits (122), Expect = 3.3e-07 Identity = 31/88 (35.23%), Postives = 44/88 (50.00%), Query Frame = 1
BLAST of CSPI06G26330 vs. TAIR10
Match: AT5G05110.1 (AT5G05110.1 Cystatin/monellin family protein) HSP 1 Score: 51.6 bits (122), Expect = 3.3e-07 Identity = 29/91 (31.87%), Postives = 49/91 (53.85%), Query Frame = 1
BLAST of CSPI06G26330 vs. NCBI nr
Match: gi|700193138|gb|KGN48342.1| (hypothetical protein Csa_6G483248 [Cucumis sativus]) HSP 1 Score: 213.4 bits (542), Expect = 1.9e-52 Identity = 100/102 (98.04%), Postives = 101/102 (99.02%), Query Frame = 1
BLAST of CSPI06G26330 vs. NCBI nr
Match: gi|659080948|ref|XP_008441065.1| (PREDICTED: cysteine proteinase inhibitor 5-like [Cucumis melo]) HSP 1 Score: 187.6 bits (475), Expect = 1.1e-44 Identity = 89/102 (87.25%), Postives = 92/102 (90.20%), Query Frame = 1
BLAST of CSPI06G26330 vs. NCBI nr
Match: gi|700193136|gb|KGN48340.1| (hypothetical protein Csa_6G483245 [Cucumis sativus]) HSP 1 Score: 142.5 bits (358), Expect = 4.1e-31 Identity = 71/94 (75.53%), Postives = 78/94 (82.98%), Query Frame = 1
BLAST of CSPI06G26330 vs. NCBI nr
Match: gi|700193106|gb|KGN48310.1| (hypothetical protein Csa_6G473520 [Cucumis sativus]) HSP 1 Score: 135.6 bits (340), Expect = 5.0e-29 Identity = 69/103 (66.99%), Postives = 81/103 (78.64%), Query Frame = 1
BLAST of CSPI06G26330 vs. NCBI nr
Match: gi|700193137|gb|KGN48341.1| (hypothetical protein Csa_6G483247 [Cucumis sativus]) HSP 1 Score: 127.9 bits (320), Expect = 1.0e-26 Identity = 63/101 (62.38%), Postives = 74/101 (73.27%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|