CSPI06G26320 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: five_prime_UTRCDS Hold the cursor over a type above to highlight its positions in the sequence below.GTAATAAGTTTGTCAATATTACAAGTAAGTAAAAGGTCTAAAATGGCTTCTGATCCAGTGTCCAACGTCTATAGTCCAGTTGAGGATCCTCAAAGTCAACGCATGAAAGAATTAGCAGAATGGATAGTAGCAGAGCACAACAAAAACGAAGGGACGCACTTGAAGTTCATTCGTATATGGAAGTGTGAGGTGCAAATTGTGAATGGAGTCAACCACCGCTTCACTTTGACGGCTAAGGATGAAAACGATTATGAAGCTGCATACATGGCTGTTGTCTTGGAGCAACAATGGAAGCATCTCAAGGAGCTCGTTTACTTTAAGAAACTCTTCTTGGCCGAATAA ATGGCTTCTGATCCAGTGTCCAACGTCTATAGTCCAGTTGAGGATCCTCAAAGTCAACGCATGAAAGAATTAGCAGAATGGATAGTAGCAGAGCACAACAAAAACGAAGGGACGCACTTGAAGTTCATTCGTATATGGAAGTGTGAGGTGCAAATTGTGAATGGAGTCAACCACCGCTTCACTTTGACGGCTAAGGATGAAAACGATTATGAAGCTGCATACATGGCTGTTGTCTTGGAGCAACAATGGAAGCATCTCAAGGAGCTCGTTTACTTTAAGAAACTCTTCTTGGCCGAATAA ATGGCTTCTGATCCAGTGTCCAACGTCTATAGTCCAGTTGAGGATCCTCAAAGTCAACGCATGAAAGAATTAGCAGAATGGATAGTAGCAGAGCACAACAAAAACGAAGGGACGCACTTGAAGTTCATTCGTATATGGAAGTGTGAGGTGCAAATTGTGAATGGAGTCAACCACCGCTTCACTTTGACGGCTAAGGATGAAAACGATTATGAAGCTGCATACATGGCTGTTGTCTTGGAGCAACAATGGAAGCATCTCAAGGAGCTCGTTTACTTTAAGAAACTCTTCTTGGCCGAATAA
BLAST of CSPI06G26320 vs. Swiss-Prot
Match: CYT1_ACTDE (Cysteine proteinase inhibitor 1 OS=Actinidia deliciosa PE=1 SV=1) HSP 1 Score: 56.2 bits (134), Expect = 2.3e-07 Identity = 27/86 (31.40%), Postives = 48/86 (55.81%), Query Frame = 1
BLAST of CSPI06G26320 vs. Swiss-Prot
Match: CYT5_ARATH (Cysteine proteinase inhibitor 5 OS=Arabidopsis thaliana GN=CYS5 PE=2 SV=2) HSP 1 Score: 55.8 bits (133), Expect = 3.1e-07 Identity = 25/84 (29.76%), Postives = 47/84 (55.95%), Query Frame = 1
BLAST of CSPI06G26320 vs. Swiss-Prot
Match: CYT6_ORYSJ (Cysteine proteinase inhibitor 6 OS=Oryza sativa subsp. japonica GN=Os03g0210200 PE=3 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 3.1e-07 Identity = 28/87 (32.18%), Postives = 50/87 (57.47%), Query Frame = 1
BLAST of CSPI06G26320 vs. Swiss-Prot
Match: CYTM_SOLTU (Multicystatin OS=Solanum tuberosum PE=1 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 4.0e-07 Identity = 24/81 (29.63%), Postives = 47/81 (58.02%), Query Frame = 1
BLAST of CSPI06G26320 vs. Swiss-Prot
Match: CYT1_ORYSJ (Cysteine proteinase inhibitor 1 OS=Oryza sativa subsp. japonica GN=Os01g0803200 PE=1 SV=2) HSP 1 Score: 53.1 bits (126), Expect = 2.0e-06 Identity = 34/95 (35.79%), Postives = 49/95 (51.58%), Query Frame = 1
BLAST of CSPI06G26320 vs. TrEMBL
Match: A0A0A0KKR3_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus GN=Csa_6G483247 PE=3 SV=1) HSP 1 Score: 206.1 bits (523), Expect = 2.0e-50 Identity = 99/99 (100.00%), Postives = 99/99 (100.00%), Query Frame = 1
BLAST of CSPI06G26320 vs. TrEMBL
Match: A0A0A0KF22_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus GN=Csa_6G473520 PE=3 SV=1) HSP 1 Score: 137.9 bits (346), Expect = 6.8e-30 Identity = 71/101 (70.30%), Postives = 79/101 (78.22%), Query Frame = 1
BLAST of CSPI06G26320 vs. TrEMBL
Match: A0A0A0KF46_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus GN=Csa_6G483245 PE=3 SV=1) HSP 1 Score: 133.7 bits (335), Expect = 1.3e-28 Identity = 67/92 (72.83%), Postives = 76/92 (82.61%), Query Frame = 1
BLAST of CSPI06G26320 vs. TrEMBL
Match: A0A0A0KIY5_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus GN=Csa_6G483248 PE=3 SV=1) HSP 1 Score: 126.7 bits (317), Expect = 1.6e-26 Identity = 63/101 (62.38%), Postives = 73/101 (72.28%), Query Frame = 1
BLAST of CSPI06G26320 vs. TrEMBL
Match: O80389_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus PE=2 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 8.1e-15 Identity = 40/86 (46.51%), Postives = 56/86 (65.12%), Query Frame = 1
BLAST of CSPI06G26320 vs. TAIR10
Match: AT5G47550.1 (AT5G47550.1 Cystatin/monellin superfamily protein) HSP 1 Score: 55.8 bits (133), Expect = 1.7e-08 Identity = 25/84 (29.76%), Postives = 47/84 (55.95%), Query Frame = 1
BLAST of CSPI06G26320 vs. TAIR10
Match: AT5G12140.1 (AT5G12140.1 cystatin-1) HSP 1 Score: 52.8 bits (125), Expect = 1.5e-07 Identity = 32/99 (32.32%), Postives = 49/99 (49.49%), Query Frame = 1
BLAST of CSPI06G26320 vs. TAIR10
Match: AT3G12490.2 (AT3G12490.2 cystatin B) HSP 1 Score: 47.4 bits (111), Expect = 6.1e-06 Identity = 29/76 (38.16%), Postives = 39/76 (51.32%), Query Frame = 1
BLAST of CSPI06G26320 vs. TAIR10
Match: AT2G40880.1 (AT2G40880.1 cystatin A) HSP 1 Score: 47.0 bits (110), Expect = 8.0e-06 Identity = 27/77 (35.06%), Postives = 41/77 (53.25%), Query Frame = 1
BLAST of CSPI06G26320 vs. NCBI nr
Match: gi|700193137|gb|KGN48341.1| (hypothetical protein Csa_6G483247 [Cucumis sativus]) HSP 1 Score: 206.1 bits (523), Expect = 2.9e-50 Identity = 99/99 (100.00%), Postives = 99/99 (100.00%), Query Frame = 1
BLAST of CSPI06G26320 vs. NCBI nr
Match: gi|700193106|gb|KGN48310.1| (hypothetical protein Csa_6G473520 [Cucumis sativus]) HSP 1 Score: 137.9 bits (346), Expect = 9.8e-30 Identity = 71/101 (70.30%), Postives = 79/101 (78.22%), Query Frame = 1
BLAST of CSPI06G26320 vs. NCBI nr
Match: gi|700193136|gb|KGN48340.1| (hypothetical protein Csa_6G483245 [Cucumis sativus]) HSP 1 Score: 133.7 bits (335), Expect = 1.8e-28 Identity = 67/92 (72.83%), Postives = 76/92 (82.61%), Query Frame = 1
BLAST of CSPI06G26320 vs. NCBI nr
Match: gi|700193138|gb|KGN48342.1| (hypothetical protein Csa_6G483248 [Cucumis sativus]) HSP 1 Score: 126.7 bits (317), Expect = 2.3e-26 Identity = 63/101 (62.38%), Postives = 73/101 (72.28%), Query Frame = 1
BLAST of CSPI06G26320 vs. NCBI nr
Match: gi|659080948|ref|XP_008441065.1| (PREDICTED: cysteine proteinase inhibitor 5-like [Cucumis melo]) HSP 1 Score: 123.6 bits (309), Expect = 1.9e-25 Identity = 62/101 (61.39%), Postives = 74/101 (73.27%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|