CSPI06G25870 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGTCTTCTCATGTAATTGTTGGAGATTATCGACCATGTGAGAATTCAGATGGTCCACATGCGAAAGAAGTAGCACAATGGGCAGTAATAGAATACAACCTAAAACACCGCCATGAACGTCCTTACTTGTACCTTCTTAGTGTATTGAAGTGCGAGTCGCAAGTGGTGGCTGGAACCAATTGGCGTCTGGGGTTGAGGTGTAAGGATGAAAATAATATTGAGGTAAACTGTGAGGCTGTTGTGTGGGAGCAGATATGGGCGAATTTCTTGGAGCTCAAATCCTTCATAGTATTCTACCCATCTTCTGGTTGA ATGTCTTCTCATGTAATTGTTGGAGATTATCGACCATGTGAGAATTCAGATGGTCCACATGCGAAAGAAGTAGCACAATGGGCAGTAATAGAATACAACCTAAAACACCGCCATGAACGTCCTTACTTGTACCTTCTTAGTGTATTGAAGTGCGAGTCGCAAGTGGTGGCTGGAACCAATTGGCGTCTGGGGTTGAGGTGTAAGGATGAAAATAATATTGAGGTAAACTGTGAGGCTGTTGTGTGGGAGCAGATATGGGCGAATTTCTTGGAGCTCAAATCCTTCATAGTATTCTACCCATCTTCTGGTTGA ATGTCTTCTCATGTAATTGTTGGAGATTATCGACCATGTGAGAATTCAGATGGTCCACATGCGAAAGAAGTAGCACAATGGGCAGTAATAGAATACAACCTAAAACACCGCCATGAACGTCCTTACTTGTACCTTCTTAGTGTATTGAAGTGCGAGTCGCAAGTGGTGGCTGGAACCAATTGGCGTCTGGGGTTGAGGTGTAAGGATGAAAATAATATTGAGGTAAACTGTGAGGCTGTTGTGTGGGAGCAGATATGGGCGAATTTCTTGGAGCTCAAATCCTTCATAGTATTCTACCCATCTTCTGGTTGA
BLAST of CSPI06G25870 vs. Swiss-Prot
Match: CYT1_ACTDE (Cysteine proteinase inhibitor 1 OS=Actinidia deliciosa PE=1 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 4.7e-11 Identity = 38/91 (41.76%), Postives = 55/91 (60.44%), Query Frame = 1
BLAST of CSPI06G25870 vs. Swiss-Prot
Match: CYT5_ARATH (Cysteine proteinase inhibitor 5 OS=Arabidopsis thaliana GN=CYS5 PE=2 SV=2) HSP 1 Score: 64.3 bits (155), Expect = 8.9e-10 Identity = 32/89 (35.96%), Postives = 48/89 (53.93%), Query Frame = 1
BLAST of CSPI06G25870 vs. Swiss-Prot
Match: CYT4_ARATH (Cysteine proteinase inhibitor 4 OS=Arabidopsis thaliana GN=CYS4 PE=3 SV=2) HSP 1 Score: 53.9 bits (128), Expect = 1.2e-06 Identity = 29/89 (32.58%), Postives = 50/89 (56.18%), Query Frame = 1
BLAST of CSPI06G25870 vs. TrEMBL
Match: A0A0A0KHK7_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus GN=Csa_6G459990 PE=3 SV=1) HSP 1 Score: 199.9 bits (507), Expect = 1.5e-48 Identity = 90/103 (87.38%), Postives = 94/103 (91.26%), Query Frame = 1
BLAST of CSPI06G25870 vs. TrEMBL
Match: A0A0A0KF17_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus GN=Csa_6G460000 PE=3 SV=1) HSP 1 Score: 197.2 bits (500), Expect = 9.8e-48 Identity = 89/103 (86.41%), Postives = 93/103 (90.29%), Query Frame = 1
BLAST of CSPI06G25870 vs. TrEMBL
Match: O80389_CUCSA (Cysteine proteinase inhibitor OS=Cucumis sativus PE=2 SV=1) HSP 1 Score: 117.5 bits (293), Expect = 9.9e-24 Identity = 52/89 (58.43%), Postives = 66/89 (74.16%), Query Frame = 1
BLAST of CSPI06G25870 vs. TrEMBL
Match: A0A0A0KHN6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G482230 PE=4 SV=1) HSP 1 Score: 88.6 bits (218), Expect = 4.9e-15 Identity = 45/86 (52.33%), Postives = 57/86 (66.28%), Query Frame = 1
BLAST of CSPI06G25870 vs. TrEMBL
Match: M0SNR0_MUSAM (Cysteine proteinase inhibitor OS=Musa acuminata subsp. malaccensis PE=3 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 1.1e-14 Identity = 43/94 (45.74%), Postives = 61/94 (64.89%), Query Frame = 1
BLAST of CSPI06G25870 vs. TAIR10
Match: AT5G47550.1 (AT5G47550.1 Cystatin/monellin superfamily protein) HSP 1 Score: 64.3 bits (155), Expect = 5.0e-11 Identity = 32/89 (35.96%), Postives = 48/89 (53.93%), Query Frame = 1
BLAST of CSPI06G25870 vs. TAIR10
Match: AT4G16500.1 (AT4G16500.1 Cystatin/monellin superfamily protein) HSP 1 Score: 53.9 bits (128), Expect = 6.8e-08 Identity = 29/89 (32.58%), Postives = 50/89 (56.18%), Query Frame = 1
BLAST of CSPI06G25870 vs. TAIR10
Match: AT2G40880.1 (AT2G40880.1 cystatin A) HSP 1 Score: 49.7 bits (117), Expect = 1.3e-06 Identity = 26/81 (32.10%), Postives = 44/81 (54.32%), Query Frame = 1
BLAST of CSPI06G25870 vs. NCBI nr
Match: gi|700193100|gb|KGN48304.1| (hypothetical protein Csa_6G459990 [Cucumis sativus]) HSP 1 Score: 199.9 bits (507), Expect = 2.2e-48 Identity = 90/103 (87.38%), Postives = 94/103 (91.26%), Query Frame = 1
BLAST of CSPI06G25870 vs. NCBI nr
Match: gi|700193101|gb|KGN48305.1| (hypothetical protein Csa_6G460000 [Cucumis sativus]) HSP 1 Score: 197.2 bits (500), Expect = 1.4e-47 Identity = 89/103 (86.41%), Postives = 93/103 (90.29%), Query Frame = 1
BLAST of CSPI06G25870 vs. NCBI nr
Match: gi|525507274|ref|NP_001267677.1| (cysteine proteinase inhibitor 5-like [Cucumis sativus]) HSP 1 Score: 117.5 bits (293), Expect = 1.4e-23 Identity = 52/89 (58.43%), Postives = 66/89 (74.16%), Query Frame = 1
BLAST of CSPI06G25870 vs. NCBI nr
Match: gi|700193130|gb|KGN48334.1| (hypothetical protein Csa_6G482230 [Cucumis sativus]) HSP 1 Score: 88.6 bits (218), Expect = 7.1e-15 Identity = 45/86 (52.33%), Postives = 57/86 (66.28%), Query Frame = 1
BLAST of CSPI06G25870 vs. NCBI nr
Match: gi|659080948|ref|XP_008441065.1| (PREDICTED: cysteine proteinase inhibitor 5-like [Cucumis melo]) HSP 1 Score: 88.2 bits (217), Expect = 9.2e-15 Identity = 41/88 (46.59%), Postives = 55/88 (62.50%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|