CSPI06G21960 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGACCAACAAGTCCTCTGAGACCAAGCAAGCTTTCTTCGTCTTCGGAGCCTTGGCGATGGGCTGGCTCGCCATTGAGATGGCTTTCAAACCCTTACTCGGTAAGGCCCGCTCCGCCATGGACAAATCTGATCCCGCTCGGGATCCTGACGAACTTCTCGATAACCAATTCGATCACACCTCATCTGATGACGATCGAAATGCCACTGGCACTGCTTAA ATGACCAACAAGTCCTCTGAGACCAAGCAAGCTTTCTTCGTCTTCGGAGCCTTGGCGATGGGCTGGCTCGCCATTGAGATGGCTTTCAAACCCTTACTCGGTAAGGCCCGCTCCGCCATGGACAAATCTGATCCCGCTCGGGATCCTGACGAACTTCTCGATAACCAATTCGATCACACCTCATCTGATGACGATCGAAATGCCACTGGCACTGCTTAA ATGACCAACAAGTCCTCTGAGACCAAGCAAGCTTTCTTCGTCTTCGGAGCCTTGGCGATGGGCTGGCTCGCCATTGAGATGGCTTTCAAACCCTTACTCGGTAAGGCCCGCTCCGCCATGGACAAATCTGATCCCGCTCGGGATCCTGACGAACTTCTCGATAACCAATTCGATCACACCTCATCTGATGACGATCGAAATGCCACTGGCACTGCTTAA
BLAST of CSPI06G21960 vs. Swiss-Prot
Match: OEP7_ARATH (Outer envelope membrane protein 7 OS=Arabidopsis thaliana GN=OEP7 PE=1 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.1e-09 Identity = 30/48 (62.50%), Postives = 38/48 (79.17%), Query Frame = 1
BLAST of CSPI06G21960 vs. TrEMBL
Match: A0A0A0KJE9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G409970 PE=4 SV=1) HSP 1 Score: 129.8 bits (325), Expect = 1.4e-27 Identity = 68/72 (94.44%), Postives = 68/72 (94.44%), Query Frame = 1
BLAST of CSPI06G21960 vs. TrEMBL
Match: A0A061DQW7_THECC (Outer envelope membrane protein 7 OS=Theobroma cacao GN=TCM_004421 PE=4 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 1.4e-11 Identity = 41/62 (66.13%), Postives = 47/62 (75.81%), Query Frame = 1
BLAST of CSPI06G21960 vs. TrEMBL
Match: U5GS80_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0002s05560g PE=4 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 6.7e-11 Identity = 40/55 (72.73%), Postives = 42/55 (76.36%), Query Frame = 1
BLAST of CSPI06G21960 vs. TrEMBL
Match: B9H870_POPTR (Outer envelope membrane family protein OS=Populus trichocarpa GN=POPTR_0005s22960g PE=4 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 8.8e-11 Identity = 37/42 (88.10%), Postives = 37/42 (88.10%), Query Frame = 1
BLAST of CSPI06G21960 vs. TrEMBL
Match: A0A0D2P8S1_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_004G081500 PE=4 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.2e-10 Identity = 36/49 (73.47%), Postives = 40/49 (81.63%), Query Frame = 1
BLAST of CSPI06G21960 vs. TAIR10
Match: AT3G52420.1 (AT3G52420.1 outer envelope membrane protein 7) HSP 1 Score: 63.5 bits (153), Expect = 6.0e-11 Identity = 30/48 (62.50%), Postives = 38/48 (79.17%), Query Frame = 1
BLAST of CSPI06G21960 vs. NCBI nr
Match: gi|700192687|gb|KGN47891.1| (hypothetical protein Csa_6G409970 [Cucumis sativus]) HSP 1 Score: 129.8 bits (325), Expect = 1.9e-27 Identity = 68/72 (94.44%), Postives = 68/72 (94.44%), Query Frame = 1
BLAST of CSPI06G21960 vs. NCBI nr
Match: gi|659097128|ref|XP_008449458.1| (PREDICTED: uncharacterized protein LOC103491335 [Cucumis melo]) HSP 1 Score: 109.0 bits (271), Expect = 3.5e-21 Identity = 55/72 (76.39%), Postives = 61/72 (84.72%), Query Frame = 1
BLAST of CSPI06G21960 vs. NCBI nr
Match: gi|1009109071|ref|XP_015888091.1| (PREDICTED: uncharacterized protein LOC107423084 [Ziziphus jujuba]) HSP 1 Score: 82.0 bits (201), Expect = 4.6e-13 Identity = 42/62 (67.74%), Postives = 50/62 (80.65%), Query Frame = 1
BLAST of CSPI06G21960 vs. NCBI nr
Match: gi|764534535|ref|XP_011458616.1| (PREDICTED: 6.7 kDa chloroplast outer envelope membrane protein [Fragaria vesca subsp. vesca]) HSP 1 Score: 80.9 bits (198), Expect = 1.0e-12 Identity = 41/65 (63.08%), Postives = 50/65 (76.92%), Query Frame = 1
BLAST of CSPI06G21960 vs. NCBI nr
Match: gi|1009164842|ref|XP_015900717.1| (PREDICTED: outer envelope membrane protein 7-like [Ziziphus jujuba]) HSP 1 Score: 78.6 bits (192), Expect = 5.1e-12 Identity = 41/67 (61.19%), Postives = 49/67 (73.13%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|