CSPI06G16920 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAATTTTCCAGGTATACCACGAGGTGCAAAATACGGCTTGATCATCGGCGTTGGAATCCCGGGCCTTCTCTTTCTAATCGGGCTGGTGTTTTACATCTGCGGCAAGTGCAAGGCCTTTGCTCGGCCCAATCGTCCAACTTCAAACCTTTCCCTTTCATTGGGCCATGAGCCCACTTCTACCAAAGCAGGCCTCGATGGCCCAACAATCGAATCATTCCCGAAAACAACATTGGGCCAGAGTCGACGACTTCCAAAGTCCAACGACACCACATGCGCCATTTGCTTGTCAGAGTACCAATCAAAGGAGACAATTAGAACTATACCAGATTGTGGTCACTTCTTTCATGCTAACTGTGTTGATGAGTGGCTTAAATTGAATGCCACGTGTCCAGTGTGTCGAACCTCGCCCGACGATTCTTCCGCCACCTCCACGCCTTCTCAATCAACGTCCGTGTCTGTGTCGTTGCCAACGTCACCCCGATTGTTGTCGCGTAATGATGACTAG ATGAATTTTCCAGGTATACCACGAGGTGCAAAATACGGCTTGATCATCGGCGTTGGAATCCCGGGCCTTCTCTTTCTAATCGGGCTGGTGTTTTACATCTGCGGCAAGTGCAAGGCCTTTGCTCGGCCCAATCGTCCAACTTCAAACCTTTCCCTTTCATTGGGCCATGAGCCCACTTCTACCAAAGCAGGCCTCGATGGCCCAACAATCGAATCATTCCCGAAAACAACATTGGGCCAGAGTCGACGACTTCCAAAGTCCAACGACACCACATGCGCCATTTGCTTGTCAGAGTACCAATCAAAGGAGACAATTAGAACTATACCAGATTGTGGTCACTTCTTTCATGCTAACTGTGTTGATGAGTGGCTTAAATTGAATGCCACGTGTCCAGTGTGTCGAACCTCGCCCGACGATTCTTCCGCCACCTCCACGCCTTCTCAATCAACGTCCGTGTCTGTGTCGTTGCCAACGTCACCCCGATTGTTGTCGCGTAATGATGACTAG ATGAATTTTCCAGGTATACCACGAGGTGCAAAATACGGCTTGATCATCGGCGTTGGAATCCCGGGCCTTCTCTTTCTAATCGGGCTGGTGTTTTACATCTGCGGCAAGTGCAAGGCCTTTGCTCGGCCCAATCGTCCAACTTCAAACCTTTCCCTTTCATTGGGCCATGAGCCCACTTCTACCAAAGCAGGCCTCGATGGCCCAACAATCGAATCATTCCCGAAAACAACATTGGGCCAGAGTCGACGACTTCCAAAGTCCAACGACACCACATGCGCCATTTGCTTGTCAGAGTACCAATCAAAGGAGACAATTAGAACTATACCAGATTGTGGTCACTTCTTTCATGCTAACTGTGTTGATGAGTGGCTTAAATTGAATGCCACGTGTCCAGTGTGTCGAACCTCGCCCGACGATTCTTCCGCCACCTCCACGCCTTCTCAATCAACGTCCGTGTCTGTGTCGTTGCCAACGTCACCCCGATTGTTGTCGCGTAATGATGACTAG
BLAST of CSPI06G16920 vs. Swiss-Prot
Match: ATL69_ARATH (Putative RING-H2 finger protein ATL69 OS=Arabidopsis thaliana GN=ATL69 PE=3 SV=1) HSP 1 Score: 131.3 bits (329), Expect = 9.7e-30 Identity = 63/132 (47.73%), Postives = 85/132 (64.39%), Query Frame = 1
BLAST of CSPI06G16920 vs. Swiss-Prot
Match: ATL22_ARATH (RING-H2 finger protein ATL22 OS=Arabidopsis thaliana GN=ATL22 PE=2 SV=2) HSP 1 Score: 111.3 bits (277), Expect = 1.0e-23 Identity = 57/122 (46.72%), Postives = 81/122 (66.39%), Query Frame = 1
BLAST of CSPI06G16920 vs. Swiss-Prot
Match: ATL20_ARATH (RING-H2 finger protein ATL20 OS=Arabidopsis thaliana GN=ATL20 PE=2 SV=2) HSP 1 Score: 107.5 bits (267), Expect = 1.5e-22 Identity = 45/73 (61.64%), Postives = 56/73 (76.71%), Query Frame = 1
BLAST of CSPI06G16920 vs. Swiss-Prot
Match: AT21A_ARATH (Putative RING-H2 finger protein ATL21A OS=Arabidopsis thaliana GN=ATL21A PE=3 SV=1) HSP 1 Score: 105.1 bits (261), Expect = 7.4e-22 Identity = 46/75 (61.33%), Postives = 57/75 (76.00%), Query Frame = 1
BLAST of CSPI06G16920 vs. Swiss-Prot
Match: ATL70_ARATH (RING-H2 finger protein ATL70 OS=Arabidopsis thaliana GN=ATL70 PE=2 SV=1) HSP 1 Score: 102.1 bits (253), Expect = 6.3e-21 Identity = 49/132 (37.12%), Postives = 75/132 (56.82%), Query Frame = 1
BLAST of CSPI06G16920 vs. TrEMBL
Match: A0A0A0KUW6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G051570 PE=4 SV=1) HSP 1 Score: 333.6 bits (854), Expect = 1.4e-88 Identity = 163/164 (99.39%), Postives = 163/164 (99.39%), Query Frame = 1
BLAST of CSPI06G16920 vs. TrEMBL
Match: M5X0E9_PRUPE (Uncharacterized protein (Fragment) OS=Prunus persica GN=PRUPE_ppa019102m2g PE=4 SV=1) HSP 1 Score: 201.4 bits (511), Expect = 8.5e-49 Identity = 92/153 (60.13%), Postives = 115/153 (75.16%), Query Frame = 1
BLAST of CSPI06G16920 vs. TrEMBL
Match: B9GL60_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0001s10610g PE=4 SV=2) HSP 1 Score: 199.5 bits (506), Expect = 3.2e-48 Identity = 95/153 (62.09%), Postives = 114/153 (74.51%), Query Frame = 1
BLAST of CSPI06G16920 vs. TrEMBL
Match: W9QMH5_9ROSA (RING-H2 finger protein ATL22 OS=Morus notabilis GN=L484_001528 PE=4 SV=1) HSP 1 Score: 198.0 bits (502), Expect = 9.4e-48 Identity = 94/151 (62.25%), Postives = 114/151 (75.50%), Query Frame = 1
BLAST of CSPI06G16920 vs. TrEMBL
Match: B9GXI1_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0003s13970g PE=4 SV=1) HSP 1 Score: 194.1 bits (492), Expect = 1.4e-46 Identity = 89/154 (57.79%), Postives = 115/154 (74.68%), Query Frame = 1
BLAST of CSPI06G16920 vs. TAIR10
Match: AT5G53110.1 (AT5G53110.1 RING/U-box superfamily protein) HSP 1 Score: 161.4 bits (407), Expect = 4.9e-40 Identity = 76/139 (54.68%), Postives = 97/139 (69.78%), Query Frame = 1
BLAST of CSPI06G16920 vs. TAIR10
Match: AT5G07040.1 (AT5G07040.1 RING/U-box superfamily protein) HSP 1 Score: 131.3 bits (329), Expect = 5.5e-31 Identity = 63/132 (47.73%), Postives = 85/132 (64.39%), Query Frame = 1
BLAST of CSPI06G16920 vs. TAIR10
Match: AT2G25410.1 (AT2G25410.1 RING/U-box superfamily protein) HSP 1 Score: 111.3 bits (277), Expect = 5.8e-25 Identity = 57/122 (46.72%), Postives = 81/122 (66.39%), Query Frame = 1
BLAST of CSPI06G16920 vs. TAIR10
Match: AT1G28040.1 (AT1G28040.1 RING/U-box superfamily protein) HSP 1 Score: 107.5 bits (267), Expect = 8.4e-24 Identity = 45/73 (61.64%), Postives = 56/73 (76.71%), Query Frame = 1
BLAST of CSPI06G16920 vs. TAIR10
Match: AT2G46495.1 (AT2G46495.1 RING/U-box superfamily protein) HSP 1 Score: 105.1 bits (261), Expect = 4.2e-23 Identity = 46/75 (61.33%), Postives = 57/75 (76.00%), Query Frame = 1
BLAST of CSPI06G16920 vs. NCBI nr
Match: gi|449464090|ref|XP_004149762.1| (PREDICTED: putative RING-H2 finger protein ATL21A [Cucumis sativus]) HSP 1 Score: 333.6 bits (854), Expect = 2.1e-88 Identity = 163/164 (99.39%), Postives = 163/164 (99.39%), Query Frame = 1
BLAST of CSPI06G16920 vs. NCBI nr
Match: gi|659102093|ref|XP_008451949.1| (PREDICTED: putative RING-H2 finger protein ATL21A [Cucumis melo]) HSP 1 Score: 307.8 bits (787), Expect = 1.2e-80 Identity = 151/161 (93.79%), Postives = 157/161 (97.52%), Query Frame = 1
BLAST of CSPI06G16920 vs. NCBI nr
Match: gi|595861377|ref|XP_007211321.1| (hypothetical protein PRUPE_ppa019102m2g, partial [Prunus persica]) HSP 1 Score: 201.4 bits (511), Expect = 1.2e-48 Identity = 92/153 (60.13%), Postives = 115/153 (75.16%), Query Frame = 1
BLAST of CSPI06G16920 vs. NCBI nr
Match: gi|566148261|ref|XP_002297975.2| (hypothetical protein POPTR_0001s10610g [Populus trichocarpa]) HSP 1 Score: 199.5 bits (506), Expect = 4.6e-48 Identity = 95/153 (62.09%), Postives = 114/153 (74.51%), Query Frame = 1
BLAST of CSPI06G16920 vs. NCBI nr
Match: gi|703064699|ref|XP_010087268.1| (RING-H2 finger protein ATL22 [Morus notabilis]) HSP 1 Score: 198.0 bits (502), Expect = 1.3e-47 Identity = 94/151 (62.25%), Postives = 114/151 (75.50%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|