CSPI06G05880 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAAGGTGGGATGAAGGGGAAAGTTTGTGTAACAGGAGGTAGTGGGTTTATAGGATCGTGGCTCGTCAAGCGCCTTCTCGAAGATGGTTACTCCGTCACAACCACTGTAAGATCTGACCCAGGTACGTCAAGGATCGGGGCTAGGAAGAAAAATGACTCTTTAGTTTGCGTAATTAAAAATGTATTCTTATAAAGTTTTTCCACTAAGCTATGCTAACTTAGATTGACAATCTAACACGATTATTTTTTCTCTCTTATTTACAGAGAAGAAAAGAGATTATAGCTTCTTAACAAATCTACCAGGAGCATCAAAGAATTAA ATGGAAGGTGGGATGAAGGGGAAAGTTTGTGTAACAGGAGGTAGTGGGTTTATAGGATCGTGGCTCGTCAAGCGCCTTCTCGAAGATGGTTACTCCGTCACAACCACTGTAAGATCTGACCCAGAGAAGAAAAGAGATTATAGCTTCTTAACAAATCTACCAGGAGCATCAAAGAATTAA ATGGAAGGTGGGATGAAGGGGAAAGTTTGTGTAACAGGAGGTAGTGGGTTTATAGGATCGTGGCTCGTCAAGCGCCTTCTCGAAGATGGTTACTCCGTCACAACCACTGTAAGATCTGACCCAGAGAAGAAAAGAGATTATAGCTTCTTAACAAATCTACCAGGAGCATCAAAGAATTAA
BLAST of CSPI06G05880 vs. Swiss-Prot
Match: VESTR_MEDSA (Vestitone reductase OS=Medicago sativa PE=1 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 3.6e-19 Identity = 40/53 (75.47%), Postives = 50/53 (94.34%), Query Frame = 1
BLAST of CSPI06G05880 vs. Swiss-Prot
Match: BEN1_ARATH (Protein BRI1-5 ENHANCED 1 OS=Arabidopsis thaliana GN=BEN1 PE=2 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 3.6e-11 Identity = 33/53 (62.26%), Postives = 41/53 (77.36%), Query Frame = 1
BLAST of CSPI06G05880 vs. Swiss-Prot
Match: DFRA_PETHY (Dihydroflavonol-4-reductase OS=Petunia hybrida GN=DFRA PE=2 SV=2) HSP 1 Score: 63.2 bits (152), Expect = 1.1e-09 Identity = 32/51 (62.75%), Postives = 35/51 (68.63%), Query Frame = 1
BLAST of CSPI06G05880 vs. Swiss-Prot
Match: TKPR1_ARATH (Tetraketide alpha-pyrone reductase 1 OS=Arabidopsis thaliana GN=TKPR1 PE=1 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 3.3e-09 Identity = 31/53 (58.49%), Postives = 37/53 (69.81%), Query Frame = 1
BLAST of CSPI06G05880 vs. Swiss-Prot
Match: DFRA_DIACA (Dihydroflavonol-4-reductase OS=Dianthus caryophyllus GN=A PE=2 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 3.3e-09 Identity = 31/56 (55.36%), Postives = 36/56 (64.29%), Query Frame = 1
BLAST of CSPI06G05880 vs. TrEMBL
Match: A0A0A0K9S9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G077400 PE=4 SV=1) HSP 1 Score: 103.2 bits (256), Expect = 1.1e-19 Identity = 46/58 (79.31%), Postives = 54/58 (93.10%), Query Frame = 1
BLAST of CSPI06G05880 vs. TrEMBL
Match: I1L6V4_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_09G269600 PE=4 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.4e-17 Identity = 41/53 (77.36%), Postives = 50/53 (94.34%), Query Frame = 1
BLAST of CSPI06G05880 vs. TrEMBL
Match: C6T8G6_SOYBN (Putative uncharacterized protein OS=Glycine max PE=2 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.4e-17 Identity = 41/53 (77.36%), Postives = 50/53 (94.34%), Query Frame = 1
BLAST of CSPI06G05880 vs. TrEMBL
Match: I1L6V5_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_09G269600 PE=4 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.4e-17 Identity = 41/53 (77.36%), Postives = 50/53 (94.34%), Query Frame = 1
BLAST of CSPI06G05880 vs. TrEMBL
Match: A0A0B2RB70_GLYSO (Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Glycine soja GN=glysoja_005178 PE=4 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.4e-17 Identity = 41/53 (77.36%), Postives = 50/53 (94.34%), Query Frame = 1
BLAST of CSPI06G05880 vs. TAIR10
Match: AT2G45400.1 (AT2G45400.1 NAD(P)-binding Rossmann-fold superfamily protein) HSP 1 Score: 68.2 bits (165), Expect = 2.0e-12 Identity = 33/53 (62.26%), Postives = 41/53 (77.36%), Query Frame = 1
BLAST of CSPI06G05880 vs. TAIR10
Match: AT4G35420.1 (AT4G35420.1 dihydroflavonol 4-reductase-like1) HSP 1 Score: 61.6 bits (148), Expect = 1.9e-10 Identity = 31/53 (58.49%), Postives = 37/53 (69.81%), Query Frame = 1
BLAST of CSPI06G05880 vs. TAIR10
Match: AT5G42800.1 (AT5G42800.1 dihydroflavonol 4-reductase) HSP 1 Score: 58.2 bits (139), Expect = 2.1e-09 Identity = 31/51 (60.78%), Postives = 33/51 (64.71%), Query Frame = 1
BLAST of CSPI06G05880 vs. TAIR10
Match: AT1G76470.1 (AT1G76470.1 NAD(P)-binding Rossmann-fold superfamily protein) HSP 1 Score: 57.4 bits (137), Expect = 3.6e-09 Identity = 31/55 (56.36%), Postives = 36/55 (65.45%), Query Frame = 1
BLAST of CSPI06G05880 vs. TAIR10
Match: AT1G09490.1 (AT1G09490.1 NAD(P)-binding Rossmann-fold superfamily protein) HSP 1 Score: 52.8 bits (125), Expect = 8.7e-08 Identity = 27/50 (54.00%), Postives = 33/50 (66.00%), Query Frame = 1
BLAST of CSPI06G05880 vs. NCBI nr
Match: gi|659120305|ref|XP_008460122.1| (PREDICTED: LOW QUALITY PROTEIN: vestitone reductase-like [Cucumis melo]) HSP 1 Score: 122.1 bits (305), Expect = 3.3e-25 Identity = 57/59 (96.61%), Postives = 59/59 (100.00%), Query Frame = 1
BLAST of CSPI06G05880 vs. NCBI nr
Match: gi|449454518|ref|XP_004145001.1| (PREDICTED: vestitone reductase-like [Cucumis sativus]) HSP 1 Score: 103.2 bits (256), Expect = 1.6e-19 Identity = 46/58 (79.31%), Postives = 54/58 (93.10%), Query Frame = 1
BLAST of CSPI06G05880 vs. NCBI nr
Match: gi|659120303|ref|XP_008460121.1| (PREDICTED: vestitone reductase-like [Cucumis melo]) HSP 1 Score: 103.2 bits (256), Expect = 1.6e-19 Identity = 45/58 (77.59%), Postives = 54/58 (93.10%), Query Frame = 1
BLAST of CSPI06G05880 vs. NCBI nr
Match: gi|1012264847|ref|XP_015947096.1| (PREDICTED: vestitone reductase-like [Arachis duranensis]) HSP 1 Score: 99.0 bits (245), Expect = 3.0e-18 Identity = 45/58 (77.59%), Postives = 54/58 (93.10%), Query Frame = 1
BLAST of CSPI06G05880 vs. NCBI nr
Match: gi|1021585901|ref|XP_016182281.1| (PREDICTED: vestitone reductase-like [Arachis ipaensis]) HSP 1 Score: 97.8 bits (242), Expect = 6.7e-18 Identity = 44/58 (75.86%), Postives = 54/58 (93.10%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |