CSPI05G14060 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGATTACCAACCACCTCCTCTCCACCCTCACCTCCGATCATCCAATTGACTATGGCTTCTATAACCTCTCTTCCGGCATCCTCGAAAACAGAGCATACGTAATCGGATTCTGCAGAGGGGATATTTTCGCAGATTCTTGCCAGAGATGCCTCAACGACTCCAGACATCTTCTCTCTTTGCGGTGTCCGACCCAGAACGAAGCCATTGGATGGTACGTTACCGGATTTGTCTCGGCAGCAATGCGACGAGTGCTCGGTTGGGGCTCTGCCTATAATCCGAAACTGCTG ATGATTACCAACCACCTCCTCTCCACCCTCACCTCCGATCATCCAATTGACTATGGCTTCTATAACCTCTCTTCCGGCATCCTCGAAAACAGAGCATACGTAATCGGATTCTGCAGAGGGGATATTTTCGCAGATTCTTGCCAGAGATGCCTCAACGACTCCAGACATCTTCTCTCTTTGCGGTGTCCGACCCAGAACGAAGCCATTGGATGGTACGTTACCGGATTTGTCTCGGCAGCAATGCGACGAGTGCTCGGTTGGGGCTCTGCCTATAATCCGAAACTGCTG ATGATTACCAACCACCTCCTCTCCACCCTCACCTCCGATCATCCAATTGACTATGGCTTCTATAACCTCTCTTCCGGCATCCTCGAAAACAGAGCATACGTAATCGGATTCTGCAGAGGGGATATTTTCGCAGATTCTTGCCAGAGATGCCTCAACGACTCCAGACATCTTCTCTCTTTGCGGTGTCCGACCCAGAACGAAGCCATTGGATGGTACGTTACCGGATTTGTCTCGGCAGCAATGCGACGAGTGCTCGGTTGGGGCTCTGCCTATAATCCGAAACTGCTG
BLAST of CSPI05G14060 vs. Swiss-Prot
Match: CRK29_ARATH (Cysteine-rich receptor-like protein kinase 29 OS=Arabidopsis thaliana GN=CRK29 PE=2 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 6.3e-10 Identity = 32/84 (38.10%), Postives = 45/84 (53.57%), Query Frame = 1
BLAST of CSPI05G14060 vs. Swiss-Prot
Match: CRK28_ARATH (Cysteine-rich receptor-like protein kinase 28 OS=Arabidopsis thaliana GN=CRK28 PE=3 SV=2) HSP 1 Score: 62.4 bits (150), Expect = 3.1e-09 Identity = 31/70 (44.29%), Postives = 41/70 (58.57%), Query Frame = 1
BLAST of CSPI05G14060 vs. TrEMBL
Match: A0A0A0LS47_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G065930 PE=4 SV=1) HSP 1 Score: 115.2 bits (287), Expect = 4.5e-23 Identity = 50/83 (60.24%), Postives = 62/83 (74.70%), Query Frame = 1
BLAST of CSPI05G14060 vs. TrEMBL
Match: A0A0A0LX64_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G065370 PE=4 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 2.4e-16 Identity = 43/69 (62.32%), Postives = 50/69 (72.46%), Query Frame = 1
BLAST of CSPI05G14060 vs. TrEMBL
Match: G8A120_MEDTR (Cysteine-rich receptor-like protein kinase OS=Medicago truncatula GN=MTR_116s0043 PE=4 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 7.0e-16 Identity = 43/83 (51.81%), Postives = 53/83 (63.86%), Query Frame = 1
BLAST of CSPI05G14060 vs. TrEMBL
Match: V7BBC3_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_007G049800g PE=4 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 7.0e-16 Identity = 42/83 (50.60%), Postives = 53/83 (63.86%), Query Frame = 1
BLAST of CSPI05G14060 vs. TrEMBL
Match: A0A0A0LX67_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G065420 PE=3 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 1.2e-15 Identity = 43/69 (62.32%), Postives = 51/69 (73.91%), Query Frame = 1
BLAST of CSPI05G14060 vs. TAIR10
Match: AT4G21410.1 (AT4G21410.1 cysteine-rich RLK (RECEPTOR-like protein kinase) 29) HSP 1 Score: 64.7 bits (156), Expect = 3.6e-11 Identity = 32/84 (38.10%), Postives = 45/84 (53.57%), Query Frame = 1
BLAST of CSPI05G14060 vs. TAIR10
Match: AT4G21400.1 (AT4G21400.1 cysteine-rich RLK (RECEPTOR-like protein kinase) 28) HSP 1 Score: 62.4 bits (150), Expect = 1.8e-10 Identity = 31/70 (44.29%), Postives = 41/70 (58.57%), Query Frame = 1
BLAST of CSPI05G14060 vs. TAIR10
Match: AT4G11490.1 (AT4G11490.1 cysteine-rich RLK (RECEPTOR-like protein kinase) 33) HSP 1 Score: 47.0 bits (110), Expect = 7.7e-06 Identity = 23/66 (34.85%), Postives = 31/66 (46.97%), Query Frame = 1
BLAST of CSPI05G14060 vs. NCBI nr
Match: gi|659067845|ref|XP_008441587.1| (PREDICTED: cysteine-rich repeat secretory protein 38-like isoform X2 [Cucumis melo]) HSP 1 Score: 140.6 bits (353), Expect = 1.4e-30 Identity = 66/83 (79.52%), Postives = 70/83 (84.34%), Query Frame = 1
BLAST of CSPI05G14060 vs. NCBI nr
Match: gi|659067843|ref|XP_008441577.1| (PREDICTED: cysteine-rich repeat secretory protein 38-like isoform X1 [Cucumis melo]) HSP 1 Score: 140.6 bits (353), Expect = 1.4e-30 Identity = 66/83 (79.52%), Postives = 70/83 (84.34%), Query Frame = 1
BLAST of CSPI05G14060 vs. NCBI nr
Match: gi|659067847|ref|XP_008441594.1| (PREDICTED: cysteine-rich repeat secretory protein 38-like isoform X3 [Cucumis melo]) HSP 1 Score: 140.6 bits (353), Expect = 1.4e-30 Identity = 66/83 (79.52%), Postives = 70/83 (84.34%), Query Frame = 1
BLAST of CSPI05G14060 vs. NCBI nr
Match: gi|659068825|ref|XP_008446476.1| (PREDICTED: cysteine-rich receptor-like protein kinase 28 [Cucumis melo]) HSP 1 Score: 115.5 bits (288), Expect = 5.0e-23 Identity = 52/83 (62.65%), Postives = 63/83 (75.90%), Query Frame = 1
BLAST of CSPI05G14060 vs. NCBI nr
Match: gi|778664887|ref|XP_011648430.1| (PREDICTED: LOW QUALITY PROTEIN: cysteine-rich receptor-like protein kinase 29 [Cucumis sativus]) HSP 1 Score: 115.2 bits (287), Expect = 6.5e-23 Identity = 50/83 (60.24%), Postives = 62/83 (74.70%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|