CSPI05G00490 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGATTGTCATTGTTGGTCCAAAGATAACGATTTAGGGTTACAAATACTTCTTCCAGATGAAAGGCAAAGTTGGCCCTTCAGAAGGAACTTTATGGGAACAACATTATTCCATTGTAGATTGGAATGGGAAAGAGGGTTTAGGGAATTTGATGCATTTTTTGTTGACGAAGATTTCGTTTATCAATTTTGTCCCAACTTTCTATGCGTTTGGATAGCCAAACAAGATGGGCTTTACATGCTGAATGAAGCTGGTCAACTTGTTTTTCATCATCATTGGAAATTGCTCCGAATGCCCTCCTTGTAA ATGGATTGTCATTGTTGGTCCAAAGATAACGATTTAGGGTTACAAATACTTCTTCCAGATGAAAGGCAAAGTTGGCCCTTCAGAAGGAACTTTATGGGAACAACATTATTCCATTGTAGATTGGAATGGGAAAGAGGGTTTAGGGAATTTGATGCATTTTTTGTTGACGAAGATTTCGTTTATCAATTTTGTCCCAACTTTCTATGCGTTTGGATAGCCAAACAAGATGGGCTTTACATGCTGAATGAAGCTGGTCAACTTGTTTTTCATCATCATTGGAAATTGCTCCGAATGCCCTCCTTGTAA ATGGATTGTCATTGTTGGTCCAAAGATAACGATTTAGGGTTACAAATACTTCTTCCAGATGAAAGGCAAAGTTGGCCCTTCAGAAGGAACTTTATGGGAACAACATTATTCCATTGTAGATTGGAATGGGAAAGAGGGTTTAGGGAATTTGATGCATTTTTTGTTGACGAAGATTTCGTTTATCAATTTTGTCCCAACTTTCTATGCGTTTGGATAGCCAAACAAGATGGGCTTTACATGCTGAATGAAGCTGGTCAACTTGTTTTTCATCATCATTGGAAATTGCTCCGAATGCCCTCCTTGTAA
BLAST of CSPI05G00490 vs. TrEMBL
Match: A0A0A0KL79_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G016040 PE=4 SV=1) HSP 1 Score: 133.3 bits (334), Expect = 1.7e-28 Identity = 53/97 (54.64%), Postives = 74/97 (76.29%), Query Frame = 1
BLAST of CSPI05G00490 vs. TrEMBL
Match: A0A0A0KSN2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G538550 PE=4 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 2.8e-23 Identity = 49/96 (51.04%), Postives = 62/96 (64.58%), Query Frame = 1
BLAST of CSPI05G00490 vs. TrEMBL
Match: A0A0A0KIQ4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G017790 PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 1.4e-14 Identity = 36/66 (54.55%), Postives = 47/66 (71.21%), Query Frame = 1
BLAST of CSPI05G00490 vs. TrEMBL
Match: M5VMC1_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa024473mg PE=4 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 3.1e-14 Identity = 37/82 (45.12%), Postives = 49/82 (59.76%), Query Frame = 1
BLAST of CSPI05G00490 vs. TrEMBL
Match: V4TYS4_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10023991mg PE=4 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 7.0e-14 Identity = 38/94 (40.43%), Postives = 51/94 (54.26%), Query Frame = 1
BLAST of CSPI05G00490 vs. TAIR10
Match: AT4G29035.1 (AT4G29035.1 Plant self-incompatibility protein S1 family) HSP 1 Score: 66.2 bits (160), Expect = 1.3e-11 Identity = 37/92 (40.22%), Postives = 49/92 (53.26%), Query Frame = 1
BLAST of CSPI05G00490 vs. TAIR10
Match: AT5G12060.1 (AT5G12060.1 Plant self-incompatibility protein S1 family) HSP 1 Score: 65.9 bits (159), Expect = 1.7e-11 Identity = 31/84 (36.90%), Postives = 45/84 (53.57%), Query Frame = 1
BLAST of CSPI05G00490 vs. TAIR10
Match: AT4G16295.1 (AT4G16295.1 S-protein homologue 1) HSP 1 Score: 62.0 bits (149), Expect = 2.5e-10 Identity = 33/93 (35.48%), Postives = 49/93 (52.69%), Query Frame = 1
BLAST of CSPI05G00490 vs. TAIR10
Match: AT4G24975.1 (AT4G24975.1 Plant self-incompatibility protein S1 family) HSP 1 Score: 59.3 bits (142), Expect = 1.6e-09 Identity = 32/76 (42.11%), Postives = 37/76 (48.68%), Query Frame = 1
BLAST of CSPI05G00490 vs. TAIR10
Match: AT5G12070.1 (AT5G12070.1 Plant self-incompatibility protein S1 family) HSP 1 Score: 53.5 bits (127), Expect = 8.7e-08 Identity = 27/69 (39.13%), Postives = 37/69 (53.62%), Query Frame = 1
BLAST of CSPI05G00490 vs. NCBI nr
Match: gi|700194417|gb|KGN49594.1| (hypothetical protein Csa_5G016040 [Cucumis sativus]) HSP 1 Score: 133.3 bits (334), Expect = 2.5e-28 Identity = 53/97 (54.64%), Postives = 74/97 (76.29%), Query Frame = 1
BLAST of CSPI05G00490 vs. NCBI nr
Match: gi|659105271|ref|XP_008453055.1| (PREDICTED: uncharacterized protein LOC103493877 [Cucumis melo]) HSP 1 Score: 130.6 bits (327), Expect = 1.6e-27 Identity = 51/97 (52.58%), Postives = 73/97 (75.26%), Query Frame = 1
BLAST of CSPI05G00490 vs. NCBI nr
Match: gi|659134192|ref|XP_008467075.1| (PREDICTED: uncharacterized protein LOC103504513, partial [Cucumis melo]) HSP 1 Score: 122.1 bits (305), Expect = 5.7e-25 Identity = 49/97 (50.52%), Postives = 71/97 (73.20%), Query Frame = 1
BLAST of CSPI05G00490 vs. NCBI nr
Match: gi|700196255|gb|KGN51432.1| (hypothetical protein Csa_5G538550 [Cucumis sativus]) HSP 1 Score: 115.9 bits (289), Expect = 4.1e-23 Identity = 49/96 (51.04%), Postives = 62/96 (64.58%), Query Frame = 1
BLAST of CSPI05G00490 vs. NCBI nr
Match: gi|659105279|ref|XP_008453057.1| (PREDICTED: uncharacterized protein LOC103493879, partial [Cucumis melo]) HSP 1 Score: 111.7 bits (278), Expect = 7.6e-22 Identity = 48/82 (58.54%), Postives = 55/82 (67.07%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|