CSPI04G10160 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.GGTTCTGTTAGTATGGAAGAAGGATGGAAGCTAGGTTCTGTTAGTATGGAAGAAGGATGGAAGCTA GGTTCTGTTAGTATGGAAGAAGGATGGAAGCTA The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |