CSPI03G22600 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGTGGAATGACCAATTACAAGTTTTAAATGCACTTGATGTAGCTAAAACAAAATGGTATCACTTTACAGCAAACATCATTACTGGAATGGGATTCTTCACTGATGCATATGATCTATTTTGTATTTCTCTTGTAACCAAATTACTTGGAAGAATATATTATCATGTTGATGGTGCACTAAAGCCAGGGACATTGCCTCCAAATGTTGCTGCTGCTGTTAATGGTGTGGCATTTGTTGGAACGTTATCAGGAAAACTCTTCTTTGGTTGGTTCGGTGACAAAATGGGAAGAAAGAGAGTTTATGGTATGACTCTAAAGTCTCTAGTGCTTATGGTTATATGTGCTCAGGACTTTCCGTTGGTCACAATTCACATTCACTTTGTTTCTTTCGATTTCGGCTTGGTTTCAGTATTGATGGTGATTACCTCTTTTGACGAGGATCGTGTCGGAGTATTCAAATAA ATGTGGAATGACCAATTACAAGTTTTAAATGCACTTGATGTAGCTAAAACAAAATGGTATCACTTTACAGCAAACATCATTACTGGAATGGGATTCTTCACTGATGCATATGATCTATTTTGTATTTCTCTTGTAACCAAATTACTTGGAAGAATATATTATCATGTTGATGGTGCACTAAAGCCAGGGACATTGCCTCCAAATGTTGCTGCTGCTGTTAATGGTGTGGCATTTGTTGGAACGTTATCAGGAAAACTCTTCTTTGGTTGGTTCGGTGACAAAATGGGAAGAAAGAGAGTTTATGGTATGACTCTAAAGTCTCTAGTGCTTATGGTTATATGTGCTCAGGACTTTCCGTTGGTCACAATTCACATTCACTTTGTTTCTTTCGATTTCGGCTTGGTTTCAGTATTGATGGTGATTACCTCTTTTGACGAGGATCGTGTCGGAGTATTCAAATAA ATGTGGAATGACCAATTACAAGTTTTAAATGCACTTGATGTAGCTAAAACAAAATGGTATCACTTTACAGCAAACATCATTACTGGAATGGGATTCTTCACTGATGCATATGATCTATTTTGTATTTCTCTTGTAACCAAATTACTTGGAAGAATATATTATCATGTTGATGGTGCACTAAAGCCAGGGACATTGCCTCCAAATGTTGCTGCTGCTGTTAATGGTGTGGCATTTGTTGGAACGTTATCAGGAAAACTCTTCTTTGGTTGGTTCGGTGACAAAATGGGAAGAAAGAGAGTTTATGGTATGACTCTAAAGTCTCTAGTGCTTATGGTTATATGTGCTCAGGACTTTCCGTTGGTCACAATTCACATTCACTTTGTTTCTTTCGATTTCGGCTTGGTTTCAGTATTGATGGTGATTACCTCTTTTGACGAGGATCGTGTCGGAGTATTCAAATAA
BLAST of CSPI03G22600 vs. Swiss-Prot
Match: PHT14_ARATH (Inorganic phosphate transporter 1-4 OS=Arabidopsis thaliana GN=PHT1-4 PE=1 SV=1) HSP 1 Score: 196.1 bits (497), Expect = 2.9e-49 Identity = 94/115 (81.74%), Postives = 105/115 (91.30%), Query Frame = 1
BLAST of CSPI03G22600 vs. Swiss-Prot
Match: PHT17_ARATH (Probable inorganic phosphate transporter 1-7 OS=Arabidopsis thaliana GN=PHT1-7 PE=2 SV=2) HSP 1 Score: 194.5 bits (493), Expect = 8.5e-49 Identity = 93/115 (80.87%), Postives = 104/115 (90.43%), Query Frame = 1
BLAST of CSPI03G22600 vs. Swiss-Prot
Match: PHT16_ORYSJ (Inorganic phosphate transporter 1-6 OS=Oryza sativa subsp. japonica GN=PHT1-6 PE=1 SV=1) HSP 1 Score: 185.3 bits (469), Expect = 5.1e-46 Identity = 87/111 (78.38%), Postives = 102/111 (91.89%), Query Frame = 1
BLAST of CSPI03G22600 vs. Swiss-Prot
Match: PHT17_ORYSJ (Probable inorganic phosphate transporter 1-7 OS=Oryza sativa subsp. japonica GN=PHT1-7 PE=2 SV=1) HSP 1 Score: 183.3 bits (464), Expect = 2.0e-45 Identity = 86/115 (74.78%), Postives = 101/115 (87.83%), Query Frame = 1
BLAST of CSPI03G22600 vs. Swiss-Prot
Match: PHT15_ARATH (Probable inorganic phosphate transporter 1-5 OS=Arabidopsis thaliana GN=PHT1-5 PE=2 SV=2) HSP 1 Score: 177.2 bits (448), Expect = 1.4e-43 Identity = 85/109 (77.98%), Postives = 97/109 (88.99%), Query Frame = 1
BLAST of CSPI03G22600 vs. TrEMBL
Match: A0A0A0LAC0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G389840 PE=4 SV=1) HSP 1 Score: 252.3 bits (643), Expect = 3.8e-64 Identity = 120/122 (98.36%), Postives = 122/122 (100.00%), Query Frame = 1
BLAST of CSPI03G22600 vs. TrEMBL
Match: A0A072UDN5_MEDTR (High affinity inorganic phosphate transporter OS=Medicago truncatula GN=MTR_7g096870 PE=4 SV=1) HSP 1 Score: 200.7 bits (509), Expect = 1.3e-48 Identity = 96/115 (83.48%), Postives = 105/115 (91.30%), Query Frame = 1
BLAST of CSPI03G22600 vs. TrEMBL
Match: W9S9A7_9ROSA (Putative inorganic phosphate transporter 1-7 OS=Morus notabilis GN=L484_009800 PE=4 SV=1) HSP 1 Score: 200.7 bits (509), Expect = 1.3e-48 Identity = 98/115 (85.22%), Postives = 105/115 (91.30%), Query Frame = 1
BLAST of CSPI03G22600 vs. TrEMBL
Match: V7CWM9_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_001G160600g PE=4 SV=1) HSP 1 Score: 200.3 bits (508), Expect = 1.7e-48 Identity = 97/115 (84.35%), Postives = 105/115 (91.30%), Query Frame = 1
BLAST of CSPI03G22600 vs. TrEMBL
Match: C3UZD4_SOYBN (Phosphate transporter 2 OS=Glycine max GN=PT2 PE=4 SV=1) HSP 1 Score: 200.3 bits (508), Expect = 1.7e-48 Identity = 97/115 (84.35%), Postives = 105/115 (91.30%), Query Frame = 1
BLAST of CSPI03G22600 vs. TAIR10
Match: AT2G38940.1 (AT2G38940.1 phosphate transporter 1;4) HSP 1 Score: 196.1 bits (497), Expect = 1.6e-50 Identity = 94/115 (81.74%), Postives = 105/115 (91.30%), Query Frame = 1
BLAST of CSPI03G22600 vs. TAIR10
Match: AT3G54700.1 (AT3G54700.1 phosphate transporter 1;7) HSP 1 Score: 194.5 bits (493), Expect = 4.8e-50 Identity = 93/115 (80.87%), Postives = 104/115 (90.43%), Query Frame = 1
BLAST of CSPI03G22600 vs. TAIR10
Match: AT2G32830.1 (AT2G32830.1 phosphate transporter 1;5) HSP 1 Score: 177.2 bits (448), Expect = 7.9e-45 Identity = 85/109 (77.98%), Postives = 97/109 (88.99%), Query Frame = 1
BLAST of CSPI03G22600 vs. TAIR10
Match: AT5G43350.1 (AT5G43350.1 phosphate transporter 1;1) HSP 1 Score: 168.7 bits (426), Expect = 2.8e-42 Identity = 82/115 (71.30%), Postives = 96/115 (83.48%), Query Frame = 1
BLAST of CSPI03G22600 vs. TAIR10
Match: AT5G43370.1 (AT5G43370.1 phosphate transporter 2) HSP 1 Score: 168.3 bits (425), Expect = 3.7e-42 Identity = 81/115 (70.43%), Postives = 96/115 (83.48%), Query Frame = 1
BLAST of CSPI03G22600 vs. NCBI nr
Match: gi|700202781|gb|KGN57914.1| (hypothetical protein Csa_3G389840 [Cucumis sativus]) HSP 1 Score: 252.3 bits (643), Expect = 5.5e-64 Identity = 120/122 (98.36%), Postives = 122/122 (100.00%), Query Frame = 1
BLAST of CSPI03G22600 vs. NCBI nr
Match: gi|659093678|ref|XP_008447657.1| (PREDICTED: inorganic phosphate transporter 1-4 [Cucumis melo]) HSP 1 Score: 210.3 bits (534), Expect = 2.4e-51 Identity = 103/115 (89.57%), Postives = 108/115 (93.91%), Query Frame = 1
BLAST of CSPI03G22600 vs. NCBI nr
Match: gi|1012014584|ref|XP_015948725.1| (PREDICTED: LOW QUALITY PROTEIN: probable inorganic phosphate transporter 1-7 [Arachis duranensis]) HSP 1 Score: 201.4 bits (511), Expect = 1.1e-48 Identity = 96/115 (83.48%), Postives = 106/115 (92.17%), Query Frame = 1
BLAST of CSPI03G22600 vs. NCBI nr
Match: gi|1009173952|ref|XP_015868091.1| (PREDICTED: inorganic phosphate transporter 1-4 [Ziziphus jujuba]) HSP 1 Score: 201.4 bits (511), Expect = 1.1e-48 Identity = 99/115 (86.09%), Postives = 105/115 (91.30%), Query Frame = 1
BLAST of CSPI03G22600 vs. NCBI nr
Match: gi|729409693|ref|XP_010555844.1| (PREDICTED: inorganic phosphate transporter 1-4-like [Tarenaya hassleriana]) HSP 1 Score: 201.1 bits (510), Expect = 1.4e-48 Identity = 98/115 (85.22%), Postives = 105/115 (91.30%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|