CSPI03G22520 (gene) Wild cucumber (PI 183967)

NameCSPI03G22520
Typegene
OrganismCucumis sativus (Wild cucumber (PI 183967))
DescriptionUnknown protein
LocationChr3 : 19101438 .. 19101638 (+)
The following sequences are available for this feature:

Gene sequence (with intron)

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
ATGGGGCTAATGCGAACGGATGGTGGAAATATGTGGCAGTCGGTGGTCGGGCTTTGCGGATGGAGGCAGGCGCAGCCGATCAACACTCCAGCATCAACGAACGACGAACCGCTTGGCTGTGGCAGACGTGTGCGGCAACGGCTTCGCCGGCGGGAAGAGGGACGCGAACAGGATGAGTCGCCGGCTGCATTTAGCGATTGA

mRNA sequence

ATGGGGCTAATGCGAACGGATGGTGGAAATATGTGGCAGTCGGTGGTCGGGCTTTGCGGATGGAGGCAGGCGCAGCCGATCAACACTCCAGCATCAACGAACGACGAACCGCTTGGCTGTGGCAGACGTGTGCGGCAACGGCTTCGCCGGCGGGAAGAGGGACGCGAACAGGATGAGTCGCCGGCTGCATTTAGCGATTGA

Coding sequence (CDS)

ATGGGGCTAATGCGAACGGATGGTGGAAATATGTGGCAGTCGGTGGTCGGGCTTTGCGGATGGAGGCAGGCGCAGCCGATCAACACTCCAGCATCAACGAACGACGAACCGCTTGGCTGTGGCAGACGTGTGCGGCAACGGCTTCGCCGGCGGGAAGAGGGACGCGAACAGGATGAGTCGCCGGCTGCATTTAGCGATTGA
The following BLAST results are available for this feature:
Match NameE-valueIdentityDescription
Match NameE-valueIdentityDescription
Match NameE-valueIdentityDescription
Match NameE-valueIdentityDescription
GO Assignments
This gene is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
cellular_component GO:0005575 cellular_component
molecular_function GO:0003674 molecular_function

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameType
CSPI03G22520.1CSPI03G22520.1mRNA


The following gene(s) are orthologous to this gene:

None

The following gene(s) are paralogous to this gene:

None

The following block(s) are covering this gene:
GeneOrganismBlock
CSPI03G22520Melon (DHL92) v3.6.1cpimedB199
CSPI03G22520Melon (DHL92) v3.6.1cpimedB238
CSPI03G22520Cucumber (Gy14) v2cgybcpiB110
CSPI03G22520Cucumber (Gy14) v2cgybcpiB118
CSPI03G22520Silver-seed gourdcarcpiB0786
CSPI03G22520Silver-seed gourdcarcpiB0813
CSPI03G22520Cucumber (Chinese Long) v3cpicucB138
CSPI03G22520Cucumber (Chinese Long) v3cpicucB144
CSPI03G22520Cucumber (Chinese Long) v3cpicucB149
CSPI03G22520Watermelon (97103) v2cpiwmbB218
CSPI03G22520Watermelon (97103) v2cpiwmbB242
CSPI03G22520Watermelon (97103) v2cpiwmbB252
CSPI03G22520Wax gourdcpiwgoB282
CSPI03G22520Wax gourdcpiwgoB307
CSPI03G22520Wild cucumber (PI 183967)cpicpiB064
CSPI03G22520Wild cucumber (PI 183967)cpicpiB102
CSPI03G22520Cucumber (Gy14) v1cgycpiB038
CSPI03G22520Cucurbita maxima (Rimu)cmacpiB522
CSPI03G22520Cucurbita maxima (Rimu)cmacpiB599
CSPI03G22520Cucurbita maxima (Rimu)cmacpiB908
CSPI03G22520Cucurbita moschata (Rifu)cmocpiB512
CSPI03G22520Cucurbita moschata (Rifu)cmocpiB587
CSPI03G22520Cucumber (Chinese Long) v2cpicuB120
CSPI03G22520Cucumber (Chinese Long) v2cpicuB127
CSPI03G22520Melon (DHL92) v3.5.1cpimeB203
CSPI03G22520Melon (DHL92) v3.5.1cpimeB239
CSPI03G22520Watermelon (Charleston Gray)cpiwcgB266
CSPI03G22520Watermelon (97103) v1cpiwmB218
CSPI03G22520Watermelon (97103) v1cpiwmB241
CSPI03G22520Cucurbita pepo (Zucchini)cpecpiB247
CSPI03G22520Cucurbita pepo (Zucchini)cpecpiB724
CSPI03G22520Bottle gourd (USVL1VR-Ls)cpilsiB214
CSPI03G22520Bottle gourd (USVL1VR-Ls)cpilsiB220