CSPI03G19330 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGCCAAAAACTGTAGCCCATCTTGAATTTAAAGTATCTGTACAAGACATCAAAATGAGGTGTATTGAGAAGGAAAGAGTAGCACTTTTATCCTTTAAGCAAAAAGTGGTGGATAATTATGATATACTCTCTTCTTGGGACACAGATGTCAACAGTGATTGTTGCAATTGGAGAGGTGTTAAGTGCAGCAACATTAATACTACCACTCATCAACATATCATTGGACTTGATCTTCATGGCTCATATAATTATGAATGGTATTTGATGGGTGAGGTTAGTTCTTCTTTGACTCAATTGTCACACCTCAACTACTTGGATCTTAGCCTTAATTGGTTTGGTCGAGTTGTCCTTGAGGATATTGCATCTCTTATTGATCTAAATTATCTCAACTTGTCTTATAATGCCTTTGCTACTTTGAATGGCTGA ATGCCAAAAACTGTAGCCCATCTTGAATTTAAAGTATCTGTACAAGACATCAAAATGAGGTGTATTGAGAAGGAAAGAGTAGCACTTTTATCCTTTAAGCAAAAAGTGGTGGATAATTATGATATACTCTCTTCTTGGGACACAGATGTCAACAGTGATTGTTGCAATTGGAGAGGTGTTAAGTGCAGCAACATTAATACTACCACTCATCAACATATCATTGGACTTGATCTTCATGGCTCATATAATTATGAATGGTATTTGATGGGTGAGGTTAGTTCTTCTTTGACTCAATTGTCACACCTCAACTACTTGGATCTTAGCCTTAATTGGTTTGGTCGAGTTGTCCTTGAGGATATTGCATCTCTTATTGATCTAAATTATCTCAACTTGTCTTATAATGCCTTTGCTACTTTGAATGGCTGA ATGCCAAAAACTGTAGCCCATCTTGAATTTAAAGTATCTGTACAAGACATCAAAATGAGGTGTATTGAGAAGGAAAGAGTAGCACTTTTATCCTTTAAGCAAAAAGTGGTGGATAATTATGATATACTCTCTTCTTGGGACACAGATGTCAACAGTGATTGTTGCAATTGGAGAGGTGTTAAGTGCAGCAACATTAATACTACCACTCATCAACATATCATTGGACTTGATCTTCATGGCTCATATAATTATGAATGGTATTTGATGGGTGAGGTTAGTTCTTCTTTGACTCAATTGTCACACCTCAACTACTTGGATCTTAGCCTTAATTGGTTTGGTCGAGTTGTCCTTGAGGATATTGCATCTCTTATTGATCTAAATTATCTCAACTTGTCTTATAATGCCTTTGCTACTTTGAATGGCTGA
BLAST of CSPI03G19330 vs. Swiss-Prot
Match: EFR_ARATH (LRR receptor-like serine/threonine-protein kinase EFR OS=Arabidopsis thaliana GN=EFR PE=1 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 9.3e-10 Identity = 42/114 (36.84%), Postives = 62/114 (54.39%), Query Frame = 1
BLAST of CSPI03G19330 vs. Swiss-Prot
Match: Y3471_ARATH (Putative receptor-like protein kinase At3g47110 OS=Arabidopsis thaliana GN=At3g47110 PE=3 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 1.3e-08 Identity = 46/140 (32.86%), Postives = 69/140 (49.29%), Query Frame = 1
BLAST of CSPI03G19330 vs. Swiss-Prot
Match: Y5694_ARATH (Probably inactive leucine-rich repeat receptor-like protein kinase At5g06940 OS=Arabidopsis thaliana GN=At5g06940 PE=3 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 3.9e-08 Identity = 38/106 (35.85%), Postives = 55/106 (51.89%), Query Frame = 1
BLAST of CSPI03G19330 vs. Swiss-Prot
Match: ERL2_ARATH (LRR receptor-like serine/threonine-protein kinase ERL2 OS=Arabidopsis thaliana GN=ERL2 PE=2 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 1.1e-07 Identity = 35/113 (30.97%), Postives = 59/113 (52.21%), Query Frame = 1
BLAST of CSPI03G19330 vs. Swiss-Prot
Match: Y3475_ARATH (Probable LRR receptor-like serine/threonine-protein kinase At3g47570 OS=Arabidopsis thaliana GN=At3g47570 PE=2 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 1.5e-07 Identity = 41/114 (35.96%), Postives = 56/114 (49.12%), Query Frame = 1
BLAST of CSPI03G19330 vs. TrEMBL
Match: A0A0A0L6M8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G232430 PE=4 SV=1) HSP 1 Score: 285.0 bits (728), Expect = 4.9e-74 Identity = 137/139 (98.56%), Postives = 139/139 (100.00%), Query Frame = 1
BLAST of CSPI03G19330 vs. TrEMBL
Match: A0A0A0LC52_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G232435 PE=4 SV=1) HSP 1 Score: 201.8 bits (512), Expect = 5.5e-49 Identity = 95/120 (79.17%), Postives = 109/120 (90.83%), Query Frame = 1
BLAST of CSPI03G19330 vs. TrEMBL
Match: A0A0A0L777_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G229430 PE=4 SV=1) HSP 1 Score: 138.3 bits (347), Expect = 7.4e-30 Identity = 74/120 (61.67%), Postives = 85/120 (70.83%), Query Frame = 1
BLAST of CSPI03G19330 vs. TrEMBL
Match: B9I512_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0012s01080g PE=4 SV=2) HSP 1 Score: 119.0 bits (297), Expect = 4.6e-24 Identity = 67/132 (50.76%), Postives = 83/132 (62.88%), Query Frame = 1
BLAST of CSPI03G19330 vs. TrEMBL
Match: A0A0R0FS76_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_16G173900 PE=4 SV=1) HSP 1 Score: 114.4 bits (285), Expect = 1.1e-22 Identity = 64/130 (49.23%), Postives = 86/130 (66.15%), Query Frame = 1
BLAST of CSPI03G19330 vs. TAIR10
Match: AT2G34930.1 (AT2G34930.1 disease resistance family protein / LRR family protein) HSP 1 Score: 75.1 bits (183), Expect = 3.9e-14 Identity = 49/126 (38.89%), Postives = 67/126 (53.17%), Query Frame = 1
BLAST of CSPI03G19330 vs. TAIR10
Match: AT5G27060.1 (AT5G27060.1 receptor like protein 53) HSP 1 Score: 66.6 bits (161), Expect = 1.4e-11 Identity = 52/150 (34.67%), Postives = 68/150 (45.33%), Query Frame = 1
BLAST of CSPI03G19330 vs. TAIR10
Match: AT5G20480.1 (AT5G20480.1 EF-TU receptor) HSP 1 Score: 64.7 bits (156), Expect = 5.3e-11 Identity = 42/114 (36.84%), Postives = 62/114 (54.39%), Query Frame = 1
BLAST of CSPI03G19330 vs. TAIR10
Match: AT3G28890.1 (AT3G28890.1 receptor like protein 43) HSP 1 Score: 62.0 bits (149), Expect = 3.4e-10 Identity = 46/151 (30.46%), Postives = 65/151 (43.05%), Query Frame = 1
BLAST of CSPI03G19330 vs. TAIR10
Match: AT5G49290.1 (AT5G49290.1 receptor like protein 56) HSP 1 Score: 61.2 bits (147), Expect = 5.8e-10 Identity = 45/127 (35.43%), Postives = 61/127 (48.03%), Query Frame = 1
BLAST of CSPI03G19330 vs. NCBI nr
Match: gi|700202487|gb|KGN57620.1| (hypothetical protein Csa_3G232430 [Cucumis sativus]) HSP 1 Score: 285.0 bits (728), Expect = 7.0e-74 Identity = 137/139 (98.56%), Postives = 139/139 (100.00%), Query Frame = 1
BLAST of CSPI03G19330 vs. NCBI nr
Match: gi|700202488|gb|KGN57621.1| (hypothetical protein Csa_3G232435 [Cucumis sativus]) HSP 1 Score: 201.8 bits (512), Expect = 7.8e-49 Identity = 95/120 (79.17%), Postives = 109/120 (90.83%), Query Frame = 1
BLAST of CSPI03G19330 vs. NCBI nr
Match: gi|659112417|ref|XP_008456210.1| (PREDICTED: polygalacturonase inhibitor-like [Cucumis melo]) HSP 1 Score: 196.1 bits (497), Expect = 4.3e-47 Identity = 92/122 (75.41%), Postives = 106/122 (86.89%), Query Frame = 1
BLAST of CSPI03G19330 vs. NCBI nr
Match: gi|700202485|gb|KGN57618.1| (hypothetical protein Csa_3G229430 [Cucumis sativus]) HSP 1 Score: 138.3 bits (347), Expect = 1.1e-29 Identity = 74/120 (61.67%), Postives = 85/120 (70.83%), Query Frame = 1
BLAST of CSPI03G19330 vs. NCBI nr
Match: gi|566196173|ref|XP_002318355.2| (hypothetical protein POPTR_0012s01080g [Populus trichocarpa]) HSP 1 Score: 119.0 bits (297), Expect = 6.7e-24 Identity = 67/132 (50.76%), Postives = 83/132 (62.88%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|