CSPI03G18970 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDSthree_prime_UTR Hold the cursor over a type above to highlight its positions in the sequence below.ATGGATTTCATTTCTCACTCCCTTTGTGGAACAAAATACATAGGTGGCCCAGCAGAGATGAAGGAGAGGTTAGCCTTTGACGATGCTAACAAATCAATAGCTTTTGAGGTCTTCGAAGGAGATCTATTAAGAGATTTTGAAGTGTTCAAAATGAAAATGCAAGTTAATAATGAGAAAGGTAGCAATGGGAGCTTAGTTAATTGGTCTATAGAATTTGTGAAGGCAAATGAAGATGTGGCTGCACCACATCAGTATCTCACAATTGCAGCTCAAACAAGCAAAACACTTGATGATTACCTTTGCAACAACTGAACCAAAAACCATATCCCCAACTTCACTTCACTGC ATGGATTTCATTTCTCACTCCCTTTGTGGAACAAAATACATAGGTGGCCCAGCAGAGATGAAGGAGAGGTTAGCCTTTGACGATGCTAACAAATCAATAGCTTTTGAGGTCTTCGAAGGAGATCTATTAAGAGATTTTGAAGTGTTCAAAATGAAAATGCAAGTTAATAATGAGAAAGGTAGCAATGGGAGCTTAGTTAATTGGTCTATAGAATTTGTGAAGGCAAATGAAGATGTGGCTGCACCACATCAGTATCTCACAATTGCAGCTCAAACAAGCAAAACACTTGATGATTACCTTTGCAACAACTGA ATGGATTTCATTTCTCACTCCCTTTGTGGAACAAAATACATAGGTGGCCCAGCAGAGATGAAGGAGAGGTTAGCCTTTGACGATGCTAACAAATCAATAGCTTTTGAGGTCTTCGAAGGAGATCTATTAAGAGATTTTGAAGTGTTCAAAATGAAAATGCAAGTTAATAATGAGAAAGGTAGCAATGGGAGCTTAGTTAATTGGTCTATAGAATTTGTGAAGGCAAATGAAGATGTGGCTGCACCACATCAGTATCTCACAATTGCAGCTCAAACAAGCAAAACACTTGATGATTACCTTTGCAACAACTGA
BLAST of CSPI03G18970 vs. Swiss-Prot
Match: MLP31_ARATH (MLP-like protein 31 OS=Arabidopsis thaliana GN=MLP31 PE=2 SV=2) HSP 1 Score: 66.6 bits (161), Expect = 1.8e-10 Identity = 31/83 (37.35%), Postives = 53/83 (63.86%), Query Frame = 1
BLAST of CSPI03G18970 vs. Swiss-Prot
Match: ML149_PAPSO (Major latex protein 149 OS=Papaver somniferum GN=MLP149 PE=2 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.2e-09 Identity = 28/92 (30.43%), Postives = 51/92 (55.43%), Query Frame = 1
BLAST of CSPI03G18970 vs. Swiss-Prot
Match: MLP15_PAPSO (Major latex protein 15 OS=Papaver somniferum GN=MLP15 PE=2 SV=2) HSP 1 Score: 60.5 bits (145), Expect = 1.3e-08 Identity = 26/87 (29.89%), Postives = 45/87 (51.72%), Query Frame = 1
BLAST of CSPI03G18970 vs. TrEMBL
Match: A0A0A0L9D7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G219190 PE=4 SV=1) HSP 1 Score: 187.2 bits (474), Expect = 1.0e-44 Identity = 94/102 (92.16%), Postives = 95/102 (93.14%), Query Frame = 1
BLAST of CSPI03G18970 vs. TrEMBL
Match: A0A0A0LA22_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G331340 PE=4 SV=1) HSP 1 Score: 174.5 bits (441), Expect = 6.8e-41 Identity = 88/102 (86.27%), Postives = 90/102 (88.24%), Query Frame = 1
BLAST of CSPI03G18970 vs. TrEMBL
Match: A0A0A0LCM8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G333840 PE=4 SV=1) HSP 1 Score: 124.4 bits (311), Expect = 8.1e-26 Identity = 61/89 (68.54%), Postives = 68/89 (76.40%), Query Frame = 1
BLAST of CSPI03G18970 vs. TrEMBL
Match: A0A0A0L771_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G337350 PE=4 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 5.3e-17 Identity = 46/89 (51.69%), Postives = 59/89 (66.29%), Query Frame = 1
BLAST of CSPI03G18970 vs. TrEMBL
Match: A0A0A0LA17_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G321300 PE=4 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 6.9e-17 Identity = 43/91 (47.25%), Postives = 61/91 (67.03%), Query Frame = 1
BLAST of CSPI03G18970 vs. TAIR10
Match: AT1G70840.1 (AT1G70840.1 MLP-like protein 31) HSP 1 Score: 66.6 bits (161), Expect = 1.0e-11 Identity = 31/83 (37.35%), Postives = 53/83 (63.86%), Query Frame = 1
BLAST of CSPI03G18970 vs. TAIR10
Match: AT1G70870.1 (AT1G70870.1 Polyketide cyclase/dehydrase and lipid transport superfamily protein) HSP 1 Score: 61.2 bits (147), Expect = 4.3e-10 Identity = 31/86 (36.05%), Postives = 49/86 (56.98%), Query Frame = 1
BLAST of CSPI03G18970 vs. TAIR10
Match: AT5G28010.1 (AT5G28010.1 Polyketide cyclase/dehydrase and lipid transport superfamily protein) HSP 1 Score: 60.1 bits (144), Expect = 9.5e-10 Identity = 29/81 (35.80%), Postives = 49/81 (60.49%), Query Frame = 1
BLAST of CSPI03G18970 vs. TAIR10
Match: AT1G23120.1 (AT1G23120.1 Polyketide cyclase/dehydrase and lipid transport superfamily protein) HSP 1 Score: 52.8 bits (125), Expect = 1.5e-07 Identity = 25/86 (29.07%), Postives = 47/86 (54.65%), Query Frame = 1
BLAST of CSPI03G18970 vs. TAIR10
Match: AT1G35310.1 (AT1G35310.1 MLP-like protein 168) HSP 1 Score: 49.3 bits (116), Expect = 1.7e-06 Identity = 25/87 (28.74%), Postives = 46/87 (52.87%), Query Frame = 1
BLAST of CSPI03G18970 vs. NCBI nr
Match: gi|778680249|ref|XP_011651277.1| (PREDICTED: major latex protein 146-like [Cucumis sativus]) HSP 1 Score: 187.2 bits (474), Expect = 1.5e-44 Identity = 94/102 (92.16%), Postives = 95/102 (93.14%), Query Frame = 1
BLAST of CSPI03G18970 vs. NCBI nr
Match: gi|778680829|ref|XP_004151203.2| (PREDICTED: major latex protein 149-like [Cucumis sativus]) HSP 1 Score: 174.5 bits (441), Expect = 9.8e-41 Identity = 88/102 (86.27%), Postives = 90/102 (88.24%), Query Frame = 1
BLAST of CSPI03G18970 vs. NCBI nr
Match: gi|700202691|gb|KGN57824.1| (hypothetical protein Csa_3G331340 [Cucumis sativus]) HSP 1 Score: 174.5 bits (441), Expect = 9.8e-41 Identity = 88/102 (86.27%), Postives = 90/102 (88.24%), Query Frame = 1
BLAST of CSPI03G18970 vs. NCBI nr
Match: gi|659114440|ref|XP_008457055.1| (PREDICTED: MLP-like protein 34 [Cucumis melo]) HSP 1 Score: 129.8 bits (325), Expect = 2.8e-27 Identity = 66/98 (67.35%), Postives = 73/98 (74.49%), Query Frame = 1
BLAST of CSPI03G18970 vs. NCBI nr
Match: gi|449464138|ref|XP_004149786.1| (PREDICTED: kirola [Cucumis sativus]) HSP 1 Score: 124.4 bits (311), Expect = 1.2e-25 Identity = 61/89 (68.54%), Postives = 68/89 (76.40%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|