CSPI03G18450 (gene) Wild cucumber (PI 183967)

NameCSPI03G18450
Typegene
OrganismCucumis sativus (Wild cucumber (PI 183967))
DescriptionUnknown protein
LocationChr3 : 14110587 .. 14110793 (-)
The following sequences are available for this feature:

Gene sequence (with intron)

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
GTAGAGTCCAATCCATGGAGCAAGGCATCCACAAAGAGTCCTTGGAGCTATATCCCTAAGCACAGTGATATTATCTGCAACAACCTCACAGGAAAGTTGGTGATGGCAGGACAACTGCTAGGAGTGATAATTGAAGTGTTTACAAGGCTGGGGTTCAGTATGATTTCCCCCAATTATTTGGTACTGCTGAAAGAAAGAATGCTTCCA

mRNA sequence

GTAGAGTCCAATCCATGGAGCAAGGCATCCACAAAGAGTCCTTGGAGCTATATCCCTAAGCACAGTGATATTATCTGCAACAACCTCACAGGAAAGTTGGTGATGGCAGGACAACTGCTAGGAGTGATAATTGAAGTGTTTACAAGGCTGGGGTTCAGTATGATTTCCCCCAATTATTTGGTACTGCTGAAAGAAAGAATGCTTCCA

Coding sequence (CDS)

GTAGAGTCCAATCCATGGAGCAAGGCATCCACAAAGAGTCCTTGGAGCTATATCCCTAAGCACAGTGATATTATCTGCAACAACCTCACAGGAAAGTTGGTGATGGCAGGACAACTGCTAGGAGTGATAATTGAAGTGTTTACAAGGCTGGGGTTCAGTATGATTTCCCCCAATTATTTGGTACTGCTGAAAGAAAGAATGCTTCCA
The following BLAST results are available for this feature:
Match NameE-valueIdentityDescription
Match NameE-valueIdentityDescription
Match NameE-valueIdentityDescription
Match NameE-valueIdentityDescription
GO Assignments
This gene is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
cellular_component GO:0005575 cellular_component
molecular_function GO:0003674 molecular_function

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameType
CSPI03G18450.1CSPI03G18450.1mRNA


The following gene(s) are orthologous to this gene:

None

The following gene(s) are paralogous to this gene:

None

The following block(s) are covering this gene:
GeneOrganismBlock
CSPI03G18450Silver-seed gourdcarcpiB0405
CSPI03G18450Silver-seed gourdcarcpiB0685
CSPI03G18450Cucumber (Chinese Long) v3cpicucB193
CSPI03G18450Cucumber (Chinese Long) v3cpicucB144
CSPI03G18450Watermelon (97103) v2cpiwmbB203
CSPI03G18450Watermelon (97103) v2cpiwmbB221
CSPI03G18450Wax gourdcpiwgoB283
CSPI03G18450Wild cucumber (PI 183967)cpicpiB144
CSPI03G18450Cucumber (Gy14) v1cgycpiB333
CSPI03G18450Cucumber (Gy14) v1cgycpiB366
CSPI03G18450Cucurbita maxima (Rimu)cmacpiB125
CSPI03G18450Cucurbita maxima (Rimu)cmacpiB326
CSPI03G18450Cucurbita maxima (Rimu)cmacpiB520
CSPI03G18450Cucurbita maxima (Rimu)cmacpiB705
CSPI03G18450Cucurbita moschata (Rifu)cmocpiB120
CSPI03G18450Cucurbita moschata (Rifu)cmocpiB315
CSPI03G18450Cucurbita moschata (Rifu)cmocpiB510
CSPI03G18450Cucurbita moschata (Rifu)cmocpiB698
CSPI03G18450Cucumber (Chinese Long) v2cpicuB120
CSPI03G18450Cucumber (Chinese Long) v2cpicuB165
CSPI03G18450Melon (DHL92) v3.5.1cpimeB241
CSPI03G18450Watermelon (Charleston Gray)cpiwcgB217
CSPI03G18450Watermelon (Charleston Gray)cpiwcgB237
CSPI03G18450Watermelon (97103) v1cpiwmB242
CSPI03G18450Watermelon (97103) v1cpiwmB271
CSPI03G18450Cucurbita pepo (Zucchini)cpecpiB208
CSPI03G18450Cucurbita pepo (Zucchini)cpecpiB388
CSPI03G18450Bottle gourd (USVL1VR-Ls)cpilsiB188
CSPI03G18450Bottle gourd (USVL1VR-Ls)cpilsiB209
CSPI03G18450Melon (DHL92) v3.6.1cpimedB239
CSPI03G18450Cucumber (Gy14) v2cgybcpiB110
CSPI03G18450Cucumber (Gy14) v2cgybcpiB315