CSPI02G26810 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAACATGGTGGAGCAAGTAGTCCCGGAGATTTCATACCTTTATGGAATTGGATTGATCCAACTGGTTTTATGAAGAAGGTGAAGAAGCTTGGAAAGACATCAGATGAATTTCTTCAACTGTTAATTGATGGGATTAGGAATCAAAATGATGGAGGAAACACCATGGTTCACCATTTACTTACCTTGCAGGATGTTGAAACCTGA ATGGAACATGGTGGAGCAAGTAGTCCCGGAGATTTCATACCTTTATGGAATTGGATTGATCCAACTGGTTTTATGAAGAAGGTGAAGAAGCTTGGAAAGACATCAGATGAATTTCTTCAACTGTTAATTGATGGGATTAGGAATCAAAATGATGGAGGAAACACCATGGTTCACCATTTACTTACCTTGCAGGATGTTGAAACCTGA ATGGAACATGGTGGAGCAAGTAGTCCCGGAGATTTCATACCTTTATGGAATTGGATTGATCCAACTGGTTTTATGAAGAAGGTGAAGAAGCTTGGAAAGACATCAGATGAATTTCTTCAACTGTTAATTGATGGGATTAGGAATCAAAATGATGGAGGAAACACCATGGTTCACCATTTACTTACCTTGCAGGATGTTGAAACCTGA
BLAST of CSPI02G26810 vs. Swiss-Prot
Match: C81E8_MEDTR (Cytochrome P450 81E8 OS=Medicago truncatula GN=CYP81E8 PE=2 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 1.1e-08 Identity = 29/61 (47.54%), Postives = 37/61 (60.66%), Query Frame = 1
BLAST of CSPI02G26810 vs. Swiss-Prot
Match: C81F2_ARATH (Cytochrome P450 81F2 OS=Arabidopsis thaliana GN=CYP81F2 PE=2 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 4.2e-08 Identity = 31/63 (49.21%), Postives = 41/63 (65.08%), Query Frame = 1
BLAST of CSPI02G26810 vs. Swiss-Prot
Match: C8D11_ARATH (Cytochrome P450 81D11 OS=Arabidopsis thaliana GN=CYP81D11 PE=2 SV=1) HSP 1 Score: 56.2 bits (134), Expect = 1.6e-07 Identity = 27/64 (42.19%), Postives = 40/64 (62.50%), Query Frame = 1
BLAST of CSPI02G26810 vs. Swiss-Prot
Match: C81F3_ARATH (Cytochrome P450 81F3 OS=Arabidopsis thaliana GN=CYP81F3 PE=2 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 4.7e-07 Identity = 29/63 (46.03%), Postives = 38/63 (60.32%), Query Frame = 1
BLAST of CSPI02G26810 vs. Swiss-Prot
Match: C81E7_MEDTR (Isoflavone 2'-hydroxylase OS=Medicago truncatula GN=CYP81E7 PE=1 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 8.0e-07 Identity = 23/65 (35.38%), Postives = 42/65 (64.62%), Query Frame = 1
BLAST of CSPI02G26810 vs. TrEMBL
Match: A0A0A0LN94_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G423680 PE=4 SV=1) HSP 1 Score: 146.7 bits (369), Expect = 1.0e-32 Identity = 66/68 (97.06%), Postives = 67/68 (98.53%), Query Frame = 1
BLAST of CSPI02G26810 vs. TrEMBL
Match: A0A0A0LMZ5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G423650 PE=4 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 1.7e-19 Identity = 45/63 (71.43%), Postives = 52/63 (82.54%), Query Frame = 1
BLAST of CSPI02G26810 vs. TrEMBL
Match: A0A0A0LTD0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G425740 PE=3 SV=1) HSP 1 Score: 99.0 bits (245), Expect = 2.4e-18 Identity = 41/67 (61.19%), Postives = 53/67 (79.10%), Query Frame = 1
BLAST of CSPI02G26810 vs. TrEMBL
Match: A0A0A0LQI5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G423640 PE=3 SV=1) HSP 1 Score: 98.6 bits (244), Expect = 3.2e-18 Identity = 39/67 (58.21%), Postives = 52/67 (77.61%), Query Frame = 1
BLAST of CSPI02G26810 vs. TrEMBL
Match: A0A0A0LNA4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G425750 PE=3 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 9.2e-18 Identity = 41/67 (61.19%), Postives = 52/67 (77.61%), Query Frame = 1
BLAST of CSPI02G26810 vs. TAIR10
Match: AT4G37330.1 (AT4G37330.1 cytochrome P450, family 81, subfamily D, polypeptide 4) HSP 1 Score: 58.9 bits (141), Expect = 1.4e-09 Identity = 25/63 (39.68%), Postives = 40/63 (63.49%), Query Frame = 1
BLAST of CSPI02G26810 vs. TAIR10
Match: AT2G23190.1 (AT2G23190.1 cytochrome P450, family 81, subfamily D, polypeptide 7) HSP 1 Score: 58.9 bits (141), Expect = 1.4e-09 Identity = 29/63 (46.03%), Postives = 38/63 (60.32%), Query Frame = 1
BLAST of CSPI02G26810 vs. TAIR10
Match: AT5G57220.1 (AT5G57220.1 cytochrome P450, family 81, subfamily F, polypeptide 2) HSP 1 Score: 58.2 bits (139), Expect = 2.4e-09 Identity = 31/63 (49.21%), Postives = 41/63 (65.08%), Query Frame = 1
BLAST of CSPI02G26810 vs. TAIR10
Match: AT3G28740.1 (AT3G28740.1 Cytochrome P450 superfamily protein) HSP 1 Score: 56.2 bits (134), Expect = 9.1e-09 Identity = 27/64 (42.19%), Postives = 40/64 (62.50%), Query Frame = 1
BLAST of CSPI02G26810 vs. TAIR10
Match: AT2G23220.1 (AT2G23220.1 cytochrome P450, family 81, subfamily D, polypeptide 6) HSP 1 Score: 56.2 bits (134), Expect = 9.1e-09 Identity = 26/61 (42.62%), Postives = 37/61 (60.66%), Query Frame = 1
BLAST of CSPI02G26810 vs. NCBI nr
Match: gi|700208169|gb|KGN63288.1| (hypothetical protein Csa_2G423680 [Cucumis sativus]) HSP 1 Score: 146.7 bits (369), Expect = 1.5e-32 Identity = 66/68 (97.06%), Postives = 67/68 (98.53%), Query Frame = 1
BLAST of CSPI02G26810 vs. NCBI nr
Match: gi|659111621|ref|XP_008455824.1| (PREDICTED: cytochrome P450 81D1-like [Cucumis melo]) HSP 1 Score: 140.2 bits (352), Expect = 1.4e-30 Identity = 62/67 (92.54%), Postives = 65/67 (97.01%), Query Frame = 1
BLAST of CSPI02G26810 vs. NCBI nr
Match: gi|449468428|ref|XP_004151923.1| (PREDICTED: cytochrome P450 81D1-like [Cucumis sativus]) HSP 1 Score: 102.8 bits (255), Expect = 2.4e-19 Identity = 45/63 (71.43%), Postives = 52/63 (82.54%), Query Frame = 1
BLAST of CSPI02G26810 vs. NCBI nr
Match: gi|700208166|gb|KGN63285.1| (hypothetical protein Csa_2G423650 [Cucumis sativus]) HSP 1 Score: 102.8 bits (255), Expect = 2.4e-19 Identity = 45/63 (71.43%), Postives = 52/63 (82.54%), Query Frame = 1
BLAST of CSPI02G26810 vs. NCBI nr
Match: gi|659111619|ref|XP_008455823.1| (PREDICTED: cytochrome P450 81D1-like [Cucumis melo]) HSP 1 Score: 102.4 bits (254), Expect = 3.1e-19 Identity = 45/63 (71.43%), Postives = 52/63 (82.54%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|